Supercharge Your Innovation With Domain-Expert AI Agents!

Rice root system phosphorus starvation induction specific expression promoter and its plant culture method

A technology of promoter and phosphorus starvation, applied in the field of genetic engineering, can solve the problem of undisclosed functions, and achieve the effects of reducing the cost of food production, reducing the application of phosphorus fertilizer, and improving phosphorus absorption capacity

Inactive Publication Date: 2006-02-01
ZHEJIANG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Mt4 / TPSI1 family genes may function as short peptides or non-coding RNAs, but functions have not been revealed so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice root system phosphorus starvation induction specific expression promoter and its plant culture method
  • Rice root system phosphorus starvation induction specific expression promoter and its plant culture method
  • Rice root system phosphorus starvation induction specific expression promoter and its plant culture method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1, Construction of Rice Suppressive Subtraction Hybridization Library

[0023] The rice Kasalath variety was soaked at 37°C to accelerate germination, sowed in a yellow sand pot, and transplanted to hydroponic culture after 7 days (the hydroponic culture formula is the standard formula of the International Rice Institute). After the seedlings were cultivated to the three-leaf stage, they began to be divided into groups, one group was cultured normally, and the other group was cultured with phosphorus starvation. After cultivating for 4 days, the materials were collected, and the root materials were collected respectively, and the total RNA was extracted with Trizol from Gibco Company. Oligotex mRNA Mini Kit from Qiagen was used to extract mRNA from 250 μg of total RNA, and 1 μg of mRNA from each of the two materials was used for cDNA synthesis using SMARTTM PCR cDNA Synthesis Kit from Clontech. The cDNA of normal cultured root tissue was used as Driver, and the...

Embodiment 2

[0024] Example 2, Cloning and determination of the cDNA sequence of rice OsIPS1Pr

[0025] Using the cDNA materials for constructing the suppressive subtraction hybridization library, the PCR-Select Differential Screening kit was used to screen the suppressive subtraction hybridization library, and clones of gene fragments strongly induced by phosphorus starvation were obtained. The clone was sequenced to obtain that the gene belonged to the plant Mt4 / TPSI1 gene family. Members of this gene family are specifically expressed by phosphorus induction. Primers were designed to amplify the promoter OsIPS1Pr of the gene. Primer 1: GAGGAGAGAAGTTTTTCGGTGGAG for 3' end amplification, primer 2: AGTTCTAGATGGGTGCTTTTATTTGGAAGTATTG for 5' amplification. The PCR product was cloned into the pT-Adv vector using the PCR Cloning Kit of Clontech Company. After transformation, the plasmid was extracted for sequencing, and a 2100bp sequence was obtained. The detailed sequence is shown in SEQ ID...

Embodiment 3

[0026]Example 3, RT-PCR analysis of OsIPS1 and transgenic expression of OsIPS1Pr and GUS fusion gene

[0027] The rice variety Nipponbare (Nipponbare) that was normally cultured to the three-leaf stage began to be stressed by phosphorus starvation, and the treatment method was consistent with the process of constructing a suppressive subtraction hybrid library. After 4 days of stress, the roots and leaves of normal seedlings and the roots and leaves of starvation-treated seedlings were taken respectively. Total RNA was extracted with Trizol reagent from Gibco. Using OsIPS1 clone as a probe for Northern blot analysis ( figure 1 ).

[0028] Using the above primers and Nipponbare genomic DNA as a template, TAQ enzyme was used to amplify the OsIPS1 promoter at 58°C, with a length of 2100bp. After smoothing the end of T4 polymerase, it was connected with SmaI digested Cambia1391z to construct OsIPS1Pr::GUS fusion gene, and then transformed into Escherichia coli DH5a. Positive c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses one kind of rice root system phosphorus starvation induction specific expression promoter and its plant culturing methodl. It includes OsIPSI gene promoter wit nucleic acid of 2100 bases all together in SEQ ID No. 1, and the nucleic acid encodes one rice root system phosphorus starvation induction specific expression promoter. The plant culturing method includes the steps of: constituting the separated DNA including SEQ ID No. 1 or its functional part and connected to the structure gene onto carrier and transferring it into crop or other plant cell; regenerating from the cell plant, structure gene product or tissue culture; and inducing the specific expression of the structure gene when the transgenic plant in phosphorus starvation state. The present invention makes it possible to raise the phosphorus absorbing ability of crop, reduce phosphate fertilizer applying amount without affecting yield and lower grain producting cost.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular, the invention relates to a specific expression promoter induced by phosphorus starvation in rice roots and a method for cultivating plants thereof. More specifically, the present invention relates to the promoter sequence of rice OsIPS1, which contains two phosphorus elements and is a specific expression promoter induced by phosphorus starvation in rice roots. The present invention also relates to the application of the phosphorus element in the promoter and its adjacent sequence, and the GUS fusion transgenic plant comprising the above-mentioned promoter and phosphorus element obtained therefrom. Background technique [0002] Phosphorus is one of the three elements (nitrogen, phosphorus, potassium) that are necessary for plant growth. Due to phosphorus (PO 4 3- , HPO 4 2- , H 2 PO 4 - ) strong fixation in acidic and alkaline soils, the efficienc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/09C12N5/10A01H1/00A01H5/00C07H21/00
Inventor 吴平侯兴亮焦芳蝉吴运荣刘非燕
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More