Unlock instant, AI-driven research and patent intelligence for your innovation.

Anti endothelial cell element, genes encoding same and pharmaceutical uses thereof

A technology of endothelial cells and coding genes, which is applied in the application field of medicine and can solve the problems of severe toxicity and side effects

Inactive Publication Date: 2004-09-01
SUN YAT SEN UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Traditional tumor treatment methods or drugs are mainly aimed at tumor cells, which often have relatively large toxic and side effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] Example 1 Cloning of anti-endothelin gene

[0016] First synthesize the following two PCR primers:

[0017] P1.CC GAATTCCATATG GTCAGCATCGGCTACCTCCTGGTGA

[0018] EcoRI NdeI

[0019] P2: CC GGATCCGCGGCCGC TAGGGCAGCGGCGCAGTGGTAGAGA

[0020] BamHI NotI

[0021] Using the total RNA of human placental umbilical cord tissue as a template, the cDNA of the NC1 region of the α2 chain of collagen IV was amplified by RT-PCR method, and then used as a template to amplify the NC1 region encoding 1 to 89 amino acids by PCR method The sequence of DNA is anti-endothelin gene cDNA. The PCR reaction conditions were as follows: denaturation at 94°C for 1 minute, annealing at 58°C for 1 minute, and extension at 72°C for 1 minute, for a total of 30 cycles. A PCR product with a length of about 300bp was obtained, digested with EcoRI and BamHI and cloned into the vector pSP72 for DNA sequence determination. The sequence results are shown in the sequence table.

Embodiment 2

[0022] Example 2 Expression of anti-endothelin gene in Escherichia coli

[0023] Use BamHI and NdeI to double-enzyme digest the PCR amplification product containing the anti-endothelin gene to recover the target fragment with a size of about 300bp and connect it to the pET-3c vector that is also double-digested with BamHI and NdeI to transform E.coli DH5α, and screen positive clones pET-CN, and then transform the recombinant plasmid into E.coli BL21(DE3) to obtain endothelin-resistant bacteria. Inoculate in LB medium and culture at 37°C until OD600=0.6, add IPTG to a final concentration of 1 mmol / L, and induce expression at 37°C for 8 hours. Detected by SDS-PAGE electrophoresis, compared with the host bacteria, there was an obvious recombinant protein expression band at the position of 10 kilodaltons. Through gel optical density scanning analysis, the expressed recombinant protein accounted for 35.3% of the total bacterial protein. The bacterium is lysed to obtain the inclus...

Embodiment 3

[0024] Example 3 Expression of anti-endothelin gene in Pichia pastoris

[0025] Use EcoRI and NotI to double-enzyme digest the PCR amplification product containing the anti-endothelin gene to recover a target fragment of about 300bp in size and connect it to the pPIC9K vector that is also double-digested with EcoRI and NotI to transform E.coli DH5α, and screen the positive clone plasmid pPIC- CN, transform the recombinant plasmid into Pichia pastoris GS115 after linearization, and screen high-copy integrated transformants on a YPD plate containing 4 mg / ml G418. Yeast transformants were inoculated with BMGY medium and cultured to OD600=2-6, then replaced with methanol-containing BMMY medium to induce expression for 48 hours.

[0026] The expressed protein is secreted into the medium, and the culture supernatant is recovered and purified by ion exchange chromatography, ultrafiltration, gel filtration, etc. to obtain purified recombinant anti-endothelin.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of gene engineering, which relates to an Endothelin resistant (esoderma cytostatic agent), its encoding gene and use in preparing medicament for resisting rumor blood vessel production, wherein the esoderma cytostatic agent is screened from No1-89 amino acid fragment of the recombined human collagen IV alpha 2 chain NC1 region, the esoderma cytostatic agent possesses the action of suppressing endocytosis breeding, and can be used in preparing medicament for suppressing blood vessel generation.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering. It relates to an anti-endothelial cell line (endothelial cell growth inhibitor) and its coding gene and the application in the preparation of anti-tumor angiogenesis drugs. Background technique [0002] Traditional tumor treatment methods or drugs are mainly aimed at tumor cells, and often have relatively large toxic and side effects. Studies in recent years have shown that strong angiogenesis is the basis for the rapid growth and metastasis of solid tumor tissues. By inhibiting the formation of new blood vessels, cutting off the blood supply and nutrient supply of the tumor can inhibit tumor growth and induce apoptosis inside the tumor. [0003] Endothelial cell growth inhibitor is a protein factor that specifically inhibits the growth of vascular endothelial cells and induces apoptosis of vascular endothelial cells. It inhibits angiogenesis by inhibiting the proliferation of vascu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/31A61K38/39A61P35/00C07K14/435C07K14/78C12N15/12C12N15/70
Inventor 罗进贤贺国安张添元
Owner SUN YAT SEN UNIV