Anti endothelial cell element, genes encoding same and pharmaceutical uses thereof
A technology of endothelial cells and coding genes, which is applied in the application field of medicine and can solve the problems of severe toxicity and side effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0015] Example 1 Cloning of anti-endothelin gene
[0016] First synthesize the following two PCR primers:
[0017] P1.CC GAATTCCATATG GTCAGCATCGGCTACCTCCTGGTGA
[0019] P2: CC GGATCCGCGGCCGC TAGGGCAGCGGCGCAGTGGTAGAGA
[0020] BamHI NotI
[0021] Using the total RNA of human placental umbilical cord tissue as a template, the cDNA of the NC1 region of the α2 chain of collagen IV was amplified by RT-PCR method, and then used as a template to amplify the NC1 region encoding 1 to 89 amino acids by PCR method The sequence of DNA is anti-endothelin gene cDNA. The PCR reaction conditions were as follows: denaturation at 94°C for 1 minute, annealing at 58°C for 1 minute, and extension at 72°C for 1 minute, for a total of 30 cycles. A PCR product with a length of about 300bp was obtained, digested with EcoRI and BamHI and cloned into the vector pSP72 for DNA sequence determination. The sequence results are shown in the sequence table.
Embodiment 2
[0022] Example 2 Expression of anti-endothelin gene in Escherichia coli
[0023] Use BamHI and NdeI to double-enzyme digest the PCR amplification product containing the anti-endothelin gene to recover the target fragment with a size of about 300bp and connect it to the pET-3c vector that is also double-digested with BamHI and NdeI to transform E.coli DH5α, and screen positive clones pET-CN, and then transform the recombinant plasmid into E.coli BL21(DE3) to obtain endothelin-resistant bacteria. Inoculate in LB medium and culture at 37°C until OD600=0.6, add IPTG to a final concentration of 1 mmol / L, and induce expression at 37°C for 8 hours. Detected by SDS-PAGE electrophoresis, compared with the host bacteria, there was an obvious recombinant protein expression band at the position of 10 kilodaltons. Through gel optical density scanning analysis, the expressed recombinant protein accounted for 35.3% of the total bacterial protein. The bacterium is lysed to obtain the inclus...
Embodiment 3
[0024] Example 3 Expression of anti-endothelin gene in Pichia pastoris
[0025] Use EcoRI and NotI to double-enzyme digest the PCR amplification product containing the anti-endothelin gene to recover a target fragment of about 300bp in size and connect it to the pPIC9K vector that is also double-digested with EcoRI and NotI to transform E.coli DH5α, and screen the positive clone plasmid pPIC- CN, transform the recombinant plasmid into Pichia pastoris GS115 after linearization, and screen high-copy integrated transformants on a YPD plate containing 4 mg / ml G418. Yeast transformants were inoculated with BMGY medium and cultured to OD600=2-6, then replaced with methanol-containing BMMY medium to induce expression for 48 hours.
[0026] The expressed protein is secreted into the medium, and the culture supernatant is recovered and purified by ion exchange chromatography, ultrafiltration, gel filtration, etc. to obtain purified recombinant anti-endothelin.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com