Method for producing antigen protein in use for hog cholera vaccine

A technology for antigenic protein and swine fever vaccine, applied in biochemical equipment and methods, botanical equipment and methods, applications, etc., to achieve the effects of high-density fermentation culture, rapid growth of prokaryotes, and low nutritional requirements

Inactive Publication Date: 2004-10-27
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF0 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The object of the invention is to solve the problem of mass production of antigenic protein for genetically engineered vaccines for swine fever

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing antigen protein in use for hog cholera vaccine
  • Method for producing antigen protein in use for hog cholera vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0036]1. Extraction of CSFV RNA from selected CSF strains

[0037] Through the analysis of the genetic derivation relationship of the E2 gene of the epidemic strain of classical swine fever, the current dominant epidemic strain or the strain with a broad antigen spectrum was selected as the virus material. In this example, the epidemic strain of classical swine fever GXYL / 2000 was selected as the virus material, from which the classical swine fever virus RNA was extracted. Using the extracted viral RNA as a template, the E2 gene was obtained by reverse transcription (RT), and then amplified by polymerase chain amplification reaction (PCR) and multi-nested polymerase chain amplification reaction (nPCR). Recording-polymerase chain amplification reaction is called RT-PCR for short.

[0038] E2 gene RT-PCR primers are as follows: E21 (forward) 5'TGTATTGACCAGACTGG 3'

[0039] E2 1' (reverse) 5'CTGCCAACCGCCGTCTATCTT 3'

[0040] E2 gene nPCR primers are as fo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
strengthaaaaaaaaaa
impedanceaaaaaaaaaa
Login to view more

Abstract

A process for preparing the antigen protein used for hog cholera vaccine includes extracting hog cholera virus RNA, reverse transcription to obtain the immune gene E2 of hog cholera virus, using E2 as template for PCR while inserting them to expression carrier of Bichia yeast, introducing the recombinant expression carrier to Bichia yeast, screening the recombinant Bichia yeast, discriminating its expression product testing its immunoactivity, determining the chosen recombinant yeast, testing and analyzing its culture condition, choosing the optimal culture condition, culturing the recombinant yeast and preparing the antigen protein of said vaccine.

Description

technical field [0001] The invention relates to a method for producing an antigenic protein for a swine fever vaccine, in particular to a method for producing an antigenic protein for a genetically engineered vaccine for swine fever by using a Pichia pastoris expression system. Membrane glycoprotein (gp55) gene (E2) yeast system expression vector, with the help of cell bioengineering technology, the recombinant expression vector integrated into the Pichia pastoris chromosome can efficiently express foreign genes in high-density cultured host bacteria, and can Antigens for the production of swine fever vaccines. Background technique [0002] Classical swine fever (CSF) is an infectious disease caused by classical swine fever virus that seriously endangers the lives of livestock and pigs. The World Organization for Animal Health (OIE) listed it as a Class A infectious disease. my country is a country with serious swine fever epidemics. Every year, pigs that die due to this d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/31C12N15/81C12P19/34C12P21/00
Inventor 刘湘涛韩雪清谢庆阁尚佑军
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap