Method for producing antigen protein in use for hog cholera vaccine
A technology for antigenic protein and swine fever vaccine, applied in biochemical equipment and methods, botanical equipment and methods, applications, etc., to achieve the effects of high-density fermentation culture, rapid growth of prokaryotes, and low nutritional requirements
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0036]1. Extraction of CSFV RNA from selected CSF strains
[0037] Through the analysis of the genetic derivation relationship of the E2 gene of the epidemic strain of classical swine fever, the current dominant epidemic strain or the strain with a broad antigen spectrum was selected as the virus material. In this example, the epidemic strain of classical swine fever GXYL / 2000 was selected as the virus material, from which the classical swine fever virus RNA was extracted. Using the extracted viral RNA as a template, the E2 gene was obtained by reverse transcription (RT), and then amplified by polymerase chain amplification reaction (PCR) and multi-nested polymerase chain amplification reaction (nPCR). Recording-polymerase chain amplification reaction is called RT-PCR for short.
[0038] E2 gene RT-PCR primers are as follows: E21 (forward) 5'TGTATTGACCAGACTGG 3'
[0039] E2 1' (reverse) 5'CTGCCAACCGCCGTCTATCTT 3'
[0040] E2 gene nPCR primers are as fo...
PUM
Property | Measurement | Unit |
---|---|---|
strength | aaaaa | aaaaa |
impedance | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com