Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

DNA vaccine carrier of carring SV40 enhancer element

A technology of DNA vaccines and vectors, applied in the fields of biotechnology and genetic immunity, can solve problems such as the difficulty of inferring the impact of DNA vaccine immunogenicity

Active Publication Date: 2005-01-05
NAT CENT FOR AIDSSTD CONTROL & PREVENTION CHINESE CENT FOR DISEASE CONTROL & PREVENTION
View PDF0 Cites 21 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, it is difficult to infer the influence of muscle tissue-specific elements on the immunogenicity of DNA vaccines, which can only be confirmed experimentally
There is no report on the effect of the 72bp enhancer-like sequence of SV40 virus on the immunogenicity of DNA vaccines in the published literature

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA vaccine carrier of carring SV40 enhancer element
  • DNA vaccine carrier of carring SV40 enhancer element
  • DNA vaccine carrier of carring SV40 enhancer element

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Construction of DNA vaccine vector pDRVISV1.0

[0026] Using a combination of PCR technology and subcloning technology, a 72bp single-copy SV40 enhancer sequence was inserted into the upstream of the pVRC2000CMV promoter to construct plasmid pDRVISV1.0 (see figure 1 ). The specific construction process is as follows.

[0027] Using plasmid pVRC2000 as a template, primers 5'SV40-CMV1 (5'-ggagcctggggactttccacaccattaccgccatgttgacattg-3' (SEQ ID NO: 1)) and 3'SV40-CMV-SacI (5'-aacagtatagcatgcataagagccaaag-3' (SEQ ID NO: 2) )) PCR amplification was carried out, and the obtained PCR product was designated as SV40-CMV1. In this reaction, a 72bp single-copy SV40 enhancer partial sequence (ggagcctggggactttccacacc (SEQ ID NO: 3)) was actually introduced upstream of the CMV promoter, and the specific band was recovered by 1% agarose gel electrophoresis with a gel recovery kit DNA (about 750bp). The PCR reaction system is:

[0028] 10×Pyrobest Buffer 5μl ...

Embodiment 2

[0087] Example 2: Construction of recombinant DNA vaccine pVRC2000-gag and pDRVISV1.0-gag

[0088] Using gagwt5SalI (5'-acgcgtcgacgccgccaccatggccgccagggccagcatc-3' (SEQ ID NO: 13)) and gags3EcoRV (5'-acgtgatatctcactggctgctggggtcgttgcc-3' (SEQ ID NO: 14)) as primers, amplified from plasmid pCRScript-gpnef by PCR HIV-1 CN54gag gene (about 1.5kb), SalI and EcoRV double restriction restriction directional clone into DNA vaccine vectors pVRC2000 and pDRVISV1.0, to obtain recombinant DNA vaccines pVRC2000-gag and pDRVISV1.0-gag, the construction process see Figure 4 .

[0089] The PCR reaction system is:

[0090] 10×Pyrobest Buffer 5μl

[0091] dNTP mix (2.5mM each) 5μl

[0092] gagwt5SalI (50 μM) 0.5 μl

[0093] gags3EcoRV (50μM) 0.5μl

[0094] pCRScript-gpnef 0.5μl

[0095] Pyrobest DNA Polymerase (5U / ml) 0.5μl

[0096] wxya 2 O 38 μl

[0097] The reaction conditions were: pre-denaturation at 94°C for 5 min; ...

Embodiment 3

[0113] Example 3: Comparison of humoral and cellular immune responses induced after immunization with pVRC2000-gag and pDRVISV1.0-gag

[0114] Prepare DNA vaccine pVRC2000-gag, pDRVISV1.0-gag and empty DNA vaccine vector plasmid DNA with Qiagen Giga Endo-Free Prep kit, dissolve them in saline respectively, and make a plasmid solution with a concentration of 1g / l. There were 5 mice in each experimental group (n=5), and 5 mice in each of the empty vector control and the blank control. The tibialis anterior muscle of both hind legs was injected, DNA vaccine immunization group and vector control group were injected with 100g / 100l plasmid DNA, and the blank control group was injected with 100l normal saline. After the initial immunization, the same dose was boosted 3 times at intervals of 2 weeks. At the 8th week, orbital blood was collected to obtain serum, and then sacrificed by dismounting the cervical spine, and the spleen was taken to make a single cell suspension (6×10 5 ce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a novel DNA vaccine particle carrier of enhancing immunogenicity of DNA vaccines, and its characteristic: it contains a segment of SV40 virus enhancer component with a length of 7bp; and the invention also discloses its application in gene immunity and also relates to a method of enhancing the immunogenicity of DNA vaccines.

Description

technical field [0001] The invention belongs to the fields of biotechnology and gene immunity. Background technique [0002] DNA vaccines are also called genetic vaccines, nucleic acid vaccines or naked DNA. This type of vaccine induces antigen-specific cellular and humoral immune responses by introducing antigen genes into the body for expression, thereby achieving the purpose of preventing or treating diseases. In 1990, Wolff JA et al. (Wolff JA, Malone RW, WilliamsP, et al. Direct gene transfer into mouse muscle in vivo. Science, 1990; 247 (4949 Pt 1): 1465-1468) found that intramuscular injection of plasmid DNA could transfer The source gene is expressed in vivo, which provides ideas for the development of new vaccines. In 1992, Tang DC et al. (Tang DC, DeVit M, Johnston SA. Genetic immunization is a simple method foreliciting an immune response. Nature. 1992; 356(6365): 152-4) conducted the first DNA vaccine experiment. Since 1997, more than 70 DNA vaccines for the p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/00A61K48/00C12N15/63C12N15/85
Inventor 邵一鸣李海山刘勇
Owner NAT CENT FOR AIDSSTD CONTROL & PREVENTION CHINESE CENT FOR DISEASE CONTROL & PREVENTION
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com