Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

SiRNA and expression carrier for inhibiting human telomerase reversed transcriptive enzyme gene expression and their pharmaceutical use

A technology of reverse transcriptase and gene expression, applied in the field of siRNA, which can solve the problems of large dose and insufficient inhibitory effect.

Inactive Publication Date: 2005-02-16
徐根兴
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

They use telomerase antisense oligonucleotides to act on thyroid cancer, prostate cancer, nasopharyngeal cancer, lung cancer, and kidney cancer cells respectively, and can inhibit the activity of telomerase in cancer cells and the proliferation of cancer cells to varying degrees. The disadvantages are The dose used is relatively large, and the inhibitory effect still cannot meet the requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SiRNA and expression carrier for inhibiting human telomerase reversed transcriptive enzyme gene expression and their pharmaceutical use
  • SiRNA and expression carrier for inhibiting human telomerase reversed transcriptive enzyme gene expression and their pharmaceutical use
  • SiRNA and expression carrier for inhibiting human telomerase reversed transcriptive enzyme gene expression and their pharmaceutical use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Construction of a bidirectional small double-stranded RNA expression vector formed by a sense strand (sense strand) and an antisense strand (antisense strand) to inhibit gene expression of telomerase reverse transcriptase.

[0033] 1. Construction of small double-stranded RNA expression vector

[0034] (1) Formation of double-stranded DNA containing the target gene

[0035] In order to express the designed small double-stranded RNA sequence (take SEQ ID NO.1 as an example) in the plasmid, first synthesize 3 primers, and use PCR technology to form corresponding double-stranded DNA containing the U6+1 promoter respectively fragment. The sequences of the three primers are:

[0036]The 3' end positive sense strand (sense) primer sequence is:

[0037] 5’-ATT GGG CCC GTC GAC ATC GAT AAA AAA GAA GCC GAA GGC CAG CACGTT CGG TGT TTC GTC CTT TCC AC-3’

[0038] (SEQ ID NO.5)

[0039] 3' end antisense strand (antisense) primer sequence is:

[0040] 5’-CCG GAA TCC TC...

Embodiment 2

[0074] Example 2. Construction of hairpin-shaped small double-stranded RNA expression vector to inhibit hTRT gene expression

[0075] The U6 promoter can efficiently express small double-stranded RNA, but this promoter does not exist in general plasmid vectors, so it is first necessary to construct this promoter.

[0076] 1. Construction of U6+1 promoter

[0077] (1) Design of U6+1 promoter PCR primers and PCR process

[0078] Primers:

[0079] 3' end primer

[0080] AATCTGCAGAAAAAGCGGACCGAAGTCCGCTCTAGATGCATGCTCGAGGTCGTCCGGTGTTTCGTCCTTTC

[0081] CAC

[0082] (SEQ ID NO.12)

[0083] 5' end primer

[0084] CGCGGATCCAAGGTCGGGCAGGAAGAGGGC

[0085] (SEQ ID NO.13)

[0086] PCR template: pTZU6+1

[0087] PCR process

[0088] 94°C for 1 minute, 57°C for 1 minute, 72°C for 1 minute, after 35 cycles, 72°C for 10 minutes, and store at 4°C.

[0089] (2) The PCR product is subjected to 1% agarose gel electrophoresis, and there is a very dark and bright band at 280bp under ultra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses SiRNA and expression carrier thereof for specifically inhibiting human telomerase enzyme reversed transcriptive enzyme gene expression and their pharmaceutical use for preparing human telomere enzyme activation related neoplastic medicines. The present invention obtains a group of human telomere enzyme inverse transcriptase gene sequences from the GenBank by using bio-computer information technology, based on the RNA disturbance technology, works out a group of siRNA which probably induce RNA disturbance, and expresses a certain amount of siRNA though chemical method synthesis or plasmid carrier, and then specifically restrains the expression of human telomere enzyme inverse transcriptase genes. Said siRNA and expression plasmid thereof can prepare highly effective and rapid antineoplastic drugs with strong specificity and low side-effects.

Description

technical field [0001] The invention relates to an siRNA, in particular to an siRNA and an expression vector for targeting and inhibiting the expression of human telomerase reverse transcriptase gene and its application in pharmacy. Background technique [0002] At present, the tumor gene therapy method for inhibiting the expression of oncogenes mainly uses antisense oligonucleotide technology (Agraival, Trends in Biotech, 1992, 10: 152) to block the expression of harmful genes. Complementary pairing forms triple strands with double-stranded DNA or hybrid double strands with RNA, thereby blocking gene replication, transcription, post-transcriptional processing, or translation. It can also stimulate RNaseH activity, degrade RNA, RNA strands in DNA hybrid duplexes or otherwise eventually block gene expression. People use antisense oligonucleotide technology to inhibit the overexpression of certain genes. However, because antisense oligonucleotide technology has no amplificat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K31/7088A61K48/00A61P35/00C12N15/113C12N15/63
Inventor 郭丹刘文华肖祥华傅更锋樊燕蓉刘新卷徐根兴
Owner 徐根兴
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com