Constructing method for candida tropicalis gene engineering recombinant bacterium
A kind of Candida tropicalis, genetic engineering technology, applied in the direction of genetic engineering, plant genetic improvement, recombinant DNA technology, etc., to achieve the effect of increasing the conversion rate of alkane, increasing the yield of dibasic acid, and increasing the rate of acid production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0030] The invention provides a method for constructing a genetically engineered recombinant strain of Candida tropicalis. The method for constructing the genetically engineered recombinant strain of Candida tropicalis takes the industrial production strain of Candida tropicalis as the starting strain, blocks one copy of the CAT gene, and constructs a gene whose carnitine acetyltransferase is partially blocked Engineering bacteria.
[0031] The specific implementation plan is:
[0032] 1. Construction of recombinant plasmid pUCSS5hyg15
[0033] According to the published DNA sequence of carnitine acetyltransferase in Candida tropicalis, two primers were designed and synthesized,
[0034] Upstream: CACTGCTTGAGCTCCACAAA,
[0035] Downstream: GCTAAATCCTGCAGGCAA,
[0036] The SacI and Sse8387I sites were introduced into the two primers, and the Candida tropicalis genomic DNA was used as a template to amplify the CAT gene by polymerase chain reaction.
[0037] The reaction conditions w...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com