Constructing method for candida tropicalis gene engineering recombinant bacterium

A kind of Candida tropicalis, genetic engineering technology, applied in the direction of genetic engineering, plant genetic improvement, recombinant DNA technology, etc., to achieve the effect of increasing the conversion rate of alkane, increasing the yield of dibasic acid, and increasing the rate of acid production

Inactive Publication Date: 2005-05-11
TSINGHUA UNIV
View PDF0 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, finding key regulatory enzymes in such a complex system is not easy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Constructing method for candida tropicalis gene engineering recombinant bacterium
  • Constructing method for candida tropicalis gene engineering recombinant bacterium
  • Constructing method for candida tropicalis gene engineering recombinant bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0030] The invention provides a method for constructing a genetically engineered recombinant strain of Candida tropicalis. The method for constructing the genetically engineered recombinant strain of Candida tropicalis takes the industrial production strain of Candida tropicalis as the starting strain, blocks one copy of the CAT gene, and constructs a gene whose carnitine acetyltransferase is partially blocked Engineering bacteria.

[0031] The specific implementation plan is:

[0032] 1. Construction of recombinant plasmid pUCSS5hyg15

[0033] According to the published DNA sequence of carnitine acetyltransferase in Candida tropicalis, two primers were designed and synthesized,

[0034] Upstream: CACTGCTTGAGCTCCACAAA,

[0035] Downstream: GCTAAATCCTGCAGGCAA,

[0036] The SacI and Sse8387I sites were introduced into the two primers, and the Candida tropicalis genomic DNA was used as a template to amplify the CAT gene by polymerase chain reaction.

[0037] The reaction conditions w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

This invention relates to a construction method of tropic Candida gene engineering strain. Initial strain is product strain for industry, blocking one copy gene of carnitine acetyl CoA CAT and constructing a gene engineering recombination strain. At the same conditions, growth state of initial and recombination strain are same. CAT enzyme activity of recombination strain drops to half of that of initial strain. Speed rate of producing acid is improved. Crop of dibasic acid and percent conversion increases obviously.

Description

Technical field [0001] The invention belongs to the technical field of biochemical engineering, and particularly relates to a method for constructing a genetically engineered recombinant bacteria of Candida tropicalis which blocks the carnitine acetyl-CoA transport enzyme responsible for the beta-oxidation process in Candida tropicalis. Background technique [0002] Dicarboxylic acid (DCA) is an important chemical raw material, which is used to synthesize engineering plastics, fragrances, cold-resistant plasticizers, coatings, liquid crystals and other materials. At present, tridecanedioic acid is mainly produced by the metabolism of alkanes by Candida tropicalis. [0003] Candida tropicalis is a diploid yeast that does not have sexual reproduction. In the process of converting alkanes to produce long-chain dibasic acids, after alkanes are transported into cells, they are first oxidized by cytochrome P450 enzymes to produce α- Monohydric alcohols are further oxidized to form α-mo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/19C12N15/54C12N15/63C12N15/66C12N15/81
Inventor 曹竹安高弘华玉涛焦鹏刘铭黄英明
Owner TSINGHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap