Helicase dependent amplification of nucleic acids

A technology of helicase and nucleic acid, applied in the field of helicase-dependent amplification of nucleic acid, which can solve the problem of extra time

Inactive Publication Date: 2005-10-26
NEW ENGLAND BIOLABS
View PDF16 Cites 28 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Furthermore, all existing amplification methods require prior heat denaturation and annealing steps to generate primer templates that can be utilized by DNA polymerases
This makes the amplification process take extra time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Helicase dependent amplification of nucleic acids
  • Helicase dependent amplification of nucleic acids
  • Helicase dependent amplification of nucleic acids

Examples

Experimental program
Comparison scheme
Effect test

Embodiment I

[0139] Cloning and purification of UVRD helicase and its auxiliary protein MUTL

[0140] 1. Cloning of genes encoding UvrD helicase and MutL proteins.

[0141] Take advantage of Impact TM Systematic cloning of genes encoding E. coli helicase II or UvrD helicase (Swissprot Accession No.: P03018) and its auxiliary protein E. coli MutL protein (Swissprot Accession No.: P23367), Impact TM The system results in the C-terminal translational fusion of a bifunctional marker consisting of a S. cerevisiae VMA intein and a chitin-binding domain (New England Biolabs, Inc. (Beverly, Mass. ))composition. This protein purification system utilizes the DTT-induced self-cleavage activity of a protein splicing element (called intein) to separate the target protein from the affinity tag (chitin-binding domain). Vent® DNA polymerase was used to amplify the UvrD gene from E. coli K12 genomic DNA using primer 5A (5'GGTGGTACCATGGACGTTTCTTACCTGCTC 3' (SEQ ID NO: 1)) and primer 3A (5'GGTGGT...

Embodiment II

[0148] Method for Amplifying Nucleic Acid Double Helix Targets

[0149] As a model system for helicase-dependent amplification, a synthetic DNA duplex was used as a template for the HDA reaction. This example illustrates the DNA duplex amplification using the UvrD HDA system. Methods for template denaturation, primer annealing and extension are described below.

[0150] Prepare 35 μl of reaction component A by mixing the following: 10 μl of 5×HDA buffer A (175 mM Tris-HCl (pH 7.5), 5 mM DTT), 0.5 μl of 70 bp-derived oligodeoxynucleotide (2 μM: 5' TGGCTGGTCACCAGAGGGTGGCGCGGACCGAGTGCGCTCGGCGGCTGCGGAGAGGGGTAGAGCAGGCAGC 3' (SEQ ID NO: 5)) and the DNA template of the bottom oligodeoxynucleotide (2 μ M: 5' GCTGCCTGCTCTACCCCTCTCCGCAGCCGCCGAGCGCACTCGGTCCGCGCCACCCTCTGGTGACCAGCCA 3' (SEQ ID NO: 6)) CATGTTAGGTTCTATGGATCGAGTCTGGCTGGTCACCAGAGGG 3' (SEQ ID NO: 7)), 1 μl of 3' primer (10 μM; 5' TCCCTTAGAGGTCACATTGGATCGAGTCGCTGCCTGCTCTACCCC 3' (SEQ ID NO: 8)), 10 μl of f...

Embodiment III

[0154] HDA amplification of specific sequences from plasmid DNA

[0155] To test whether HDA can be used to amplify specific target sequences in DNA templates, we applied the UvrD HDA system and used two pUC19 / M13 universal primers—primer 1224 and primer 1233—to amplify the 2647bp DNA plasmid pAH1 (Fig. 110 bp sequence in 15 (SEQ ID NO: 9)). Primer 1224 and Primer 1233 are commercially available, and their sequences can be obtained from a company (New England Biolabs, Inc., (Beverly, MA)). The amplification scheme is depicted in Figure 3.

[0156] Prepare two acetate reaction buffers: 10×HDA buffer A, containing 350mM Tris-acetate (pH7.5) and 100mM DTT; 10×HDA buffer B, containing 10mM Tris-acetate (pH7. 5), 1 mg / ml BSA and 90 mM magnesium acetate. Prepare HDA Reaction Component A by combining:

[0157] 5 μl of 10x HDA Buffer A

[0158]1.5 μl of 23 nM AhdI-cut pAH1 plasmid

[0159] 1 μl of 10 μM primer 1224

[0160] 1 μl of 10 μM primer 1233

[0161] 2 μl o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Methods and a kit are provided for selectively and exponentially amplifying nucleic acids and include the use of a helicase preparation and a DNA polymerase such that the amplification can be performed isothermally.

Description

technical field [0001] Embodiments of the invention relate to methods of using helicases to exponentially and selectively amplify target nucleic acids, and the use of these methods to detect nucleic acids in a sample. Background technique [0002] Nucleic acid amplification is widely used in research, law, medicine and agriculture. One of the best known amplification methods is the polymerase chain reaction (PCR), a method of targeted amplification (see eg US Patent Nos. 4,683,195, 4,683,202 and 4,800,159). PCR reactions typically use two oligonucleotide primers that hybridize to the 5' and 3' ends of the target sequence and a DNA polymerase to generate a double-stranded product by adding deoxynucleoside triphosphates (dNTPs) to extend the annealed primers. By raising and lowering the temperature of the reaction mixture, the two strands of DNA are separated and serve as templates for the next cycle of annealing and extension, and the process repeats. [0003] Although PCR...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P19/34
InventorH·孔M·文森特Y·徐
OwnerNEW ENGLAND BIOLABS