Fumor invasion and metastasis resisting function and use of venin cysteine proteinase inhibitor

A cysteine ​​protease and inhibitor technology, applied in the field of medical biology, can solve the problem that snake venom cysteine ​​protease inhibitors have not been reported in literature and the like

Inactive Publication Date: 2006-06-07
FUJIAN MEDICAL UNIV
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Retrieval of relevant materials including Chinese patents shows that snake venom cysteine ​​protease inhibitor (sv-Cystatin) has a

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fumor invasion and metastasis resisting function and use of venin cysteine proteinase inhibitor
  • Fumor invasion and metastasis resisting function and use of venin cysteine proteinase inhibitor
  • Fumor invasion and metastasis resisting function and use of venin cysteine proteinase inhibitor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1: Cloning of sv-Cystatin cDNA

[0045] According to the 99 amino acid sequence (SEQ ID NO.1) of the Chinese cobra venom cysteine ​​protease inhibitor (sv-Cystatin) protein, according to the yeast dominant codon, deduce its cDNA sequence (SEQ ID NO.2); according to SEQ ID NO.2 sequence, design four partially complementary oligonucleotides C1, C2, C3 and C4 corresponding to artificial synthesis, and 4 pairs of PCR primers P1, P2, P3 and P4.

[0046] Its sequence is as follows:

[0047] C1 sequence:

[0048] ATCCCAGGTGGTTTGTCTCCAAGATCTGTTTCTGACCCAGACGTTC 46

[0049] AAAAGGCTGCIGCIITCGCTGTTCAAGAAATACAACGCTGGTTCTG 91

[0050] C2 sequence

[0051] ACTTTTCACCAGCAACAGATTGAGATTGAGCTTCAACAACTTCTCAA 46

[0052] TTCCTTGTAGTAGTGAGCGTTAGCAGAACCAGCGTTGTATTCTTG 91

[0053] C3 sequence

[0054] ATCTGTTGCTGGTGAAAAGTACTTCTTGATGATGGAATTGGTTAAG 46

[0055] ACTAAGTGTGCTAAGACTGCTGGTAAGCCAAAGGTTTACAAGGA 90

[0056] C4 sequence

[0057] CCAAACTTGGAAACCCACAACTTTTCTTCTTGTTGCTTG...

Embodiment 2

[0064] Example 2: Construction of pPICZ-sv-Cystatin Pichia secretory expression vector

[0065] Using sv-Cystatin cDNA as a PCR template, the upstream primer F1 (5'-CG GAATTC ATCCCAGGTGGTTTGTCTCC-3', the underline is EcoR I restriction site) and downstream primer R1 (5'-GC TCTAGA AACCAAACTTGGAAACCAC-3', the underline is the Xba I restriction site) PCR amplification of the sv-Cystatin DNA fragment containing the corresponding restriction site.

[0066] ECOR I / Xba I double digested sv-Cystatin DNA fragment and Pichia pastoris expression vector pPICZαA, ligated and transformed E.coli.Top10, screened positive recombinants, extracted plasmids for DNA sequencing and identification. The results showed that the sv-Cystatin DNA insert sequence and The reading frame was completely correct, and the constructed vector was named pPICZ-sv-Cystatin.

Embodiment 3

[0067] Example 3: Screening Pichia genetically engineered bacteria that stably and efficiently express sv-Cystatin

[0068] The pPICZ-sv-Cystatin vector was digested with SacI to make it linear, and the Pichia GS115 competent cells prepared by electroporation were transformed with 1M sorbitol, and the transformed bacteria solution was coated on the YPDS plate (YPD Culture medium: 1% yeast extract, 2% peptone and 2% glucose), cultured upside down at 30°C, observe the formation of recombinant colonies after 2-4 days.

[0069] Use a sterilized toothpick to plant the transformed single colony on the MMH and MDH plates (MMH medium: 1.34% yeast medium YNB, 4 × 10 -5 % biotin, 0.5% methanol, 4×10-4 histidine MDH medium: 1.34% YNB, 4×10 -5 % biotin, 2% glucose, 4×10-4 histidine), cultured upside down at 30°C for 2-3 days.

[0070]Judging the phenotype according to the difference in the growth rate of the colony on the MMH and MDH plates: the colony that grows normally on both the MM...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention discloses the tumor invasion and metastasis resisting function and application of venin cysteine proteinase inhibitor, and belongs to the field of biomedicine. Through designing and synthesizing sv-Cystatin cDNA according to 99 amino acid sequences of Chinese cobra venin Cystatin protein, cloning to pPICZ alphaA vector and transforming Pichia yeast, stable and high expression engineering bacterium GS115-sv-Cystatin is screened out. Through further inducing expression and purification, the extracorporeal bioactivity experiment shows that the recombinant sv-Cystatin protein has the functions of inhibiting the activity of papain and inhibiting the tumor cell invasion and metastasis obviously, and so do the intracorporeal experiment. The present invention also constitutes pcDNA-sv-Cystatin eukaryotic expression vector. The present invention has huge application foreground in preventing and treating tumor.

Description

technical field [0001] The invention relates to the field of medical biology, in particular to a snake venom cysteine ​​protease inhibitor for anti-tumor invasion and metastasis and its application. Background technique [0002] According to clinical statistics, more than 80% of tumor patients died of invasion and metastasis. If the tumor does not invade and metastasize, the prognosis is generally good. For example, ovarian cysts and lipomas can grow to more than ten kilograms or more. Can fully restore health. Therefore, tumor invasion and metastasis are one of the most important factors affecting the survival of cancer patients. [0003] The invasion and metastasis of tumor cells is a series of complex, multi-step and multi-factor interaction dynamic process between tumor cells, host cells and extracellular matrix. Many data have proved that proteolytic enzymes secreted by tumor cells, including metalloproteinases and cysteine ​​proteases, play an important role in the p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K38/57A61K48/00A61P35/00A61P35/02C12N15/81
Inventor 林建银林旭万榕
Owner FUJIAN MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap