Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bacterial speices and method for producing succinic acid by microbial fermentation

A technology of microbial fermentation and succinic acid, which is applied in the field of bioengineering, can solve the problems of unsuitable industrial production, high requirements for culture and fermentation conditions, and difficulty in obtaining strains, and achieves the effect of alleviating the shortage of petrochemical resources and being environmentally friendly.

Inactive Publication Date: 2006-08-09
JIANGNAN UNIV
View PDF2 Cites 44 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But in China, these strains are not easy to obtain, and the cultivation and fermentation conditions are high, so they are not suitable for domestic industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Sampling was taken from the fresh rumen of cattle that had just been slaughtered in a beef cattle slaughterhouse in Wuxi City, and the digested matter in the rumen was taken and inoculated into a triangular flask filled with 80 mL of rich medium containing sodium fumarate, and cultured anaerobically at 37°C for about 36- After 48 hours, two more enrichments were carried out according to the inoculum size of 10%. Dilute the enriched culture with PBS (0.145mol / L sodium chloride, 0.01mol / L sodium phosphate aqueous solution) and spread it on the selective plate of the plate screening medium with sodium fumarate as the only carbon source, and culture 48h. Select the colony with a larger transparent circle, inoculate it into a test tube containing 5 mL of fermentation medium, and culture it anaerobically for 36 h. The supernatant was determined by the TCL method, and 72 colonies similar to succinic acid spots were selected out of 160 colonies.

[0031] Among them: enrichmen...

Embodiment 2

[0035] The retained strains were transferred to a test tube containing 5 mL of the above-mentioned fermentation medium, and cultured anaerobically at 37° C. for 36 h. Take 5mL of the culture solution and transfer it to a conical flask containing 80ml of the same fermentation medium, add sterilized calcium carbonate, control the pH to 6.5, and culture it anaerobically at 37°C for 48 hours, filter it, and measure the supernatant by HPLC The content of succinic acid in the liquid. Most of the strains had high lactic acid content, and only No. II-80 (laboratory number SW0580) produced succinic acid significantly.

[0036]

Embodiment 3

[0038] The physiological and biochemical characteristics of the screened SW0580 strain were identified according to the "Bergey's Bacteria Identification Manual (Eighth Edition)" (see Table 2), and the chromosomal DNA was extracted according to the method of the refined molecular biology experiment guide, with Y1 and Y2 as the Forward and reverse primers (Y1: ATTGAACGCTGGCGGCAGGC, Y2: CGGGCGGTGTGTACAAGGCC) were used to amplify the 16S rRNA gene by PCR, and Shanghai Shennengbo Biotechnology Co., Ltd. was commissioned to perform 16S rDNA sequencing. The 16S rRNA gene sequences of related strains in GenBank were searched by BLAST on the website, and the homology comparison was performed (Table 3). Based on the 16S rDNA sequence analysis and the identification of physiological and biochemical characteristics, combined with the study of the growth and fermentation characteristics of the bacteria, compared with the closest (or highest homology) strain Actinobacillus succinogenes ATCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention relates to a method for producing succinic acid type culture by animalcule fermentation, especially relating to an animalcule actinobacillus succinogenes SW0580 generating succinic acid by a fermentated sugariness raw material, its preservation number: CGMCC No. 1593 and a method for utilizing said animalcule fermentation to produce succinic acid, in which, said animalcule is the actinobacillus succinogenes separated from the rumen tested and 10-50g / L succinic acid can be produced by anaerobic fermentating 20-100g / L sugariness raw materials.

Description

technical field [0001] The invention discloses a bacterial strain and a method for producing succinic acid by microbial fermentation, which belong to the technical field of bioengineering. Specifically, the invention relates to a strain and a method for producing succinic acid by using an anaerobic microorganism to ferment biomass raw materials. Background technique [0002] Succinic acid, also known as succinic acid, has the molecular formula C 4 h 6 o 4 , with a molecular weight of 118.09, is a common natural organic acid that widely exists in the human body, animals, plants and microorganisms. [0003] Succinic acid is an important four-carbon compound in industry. It is widely used in food, medicine, pesticides, dyes, spices, paints, plastics and material industries as organic synthesis raw materials, intermediate products or professional chemicals. Its largest market is in the fields of surfactants, detergents, green solvents, ion chelating agents, and biodegradable...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20C12P7/46
Inventor 孙志浩郑璞刘宇鹏朱蕾蕾
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com