Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Construction method for sandwiched antibody chip detection system based on single chain antibody fusion protein

A single-chain antibody and fusion protein technology, applied in the fields of gene fusion and protein chips, can solve the problems of expensive prion detection sensitivity, cumbersome monoclonal antibody screening and preparation, and failure to meet actual detection requirements, and achieve the effect of maintaining affinity

Inactive Publication Date: 2006-11-22
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although monoclonal antibodies have high affinity, the screening and preparation of monoclonal antibodies are cumbersome and expensive, and the sensitivity of prion detection still cannot meet the actual detection requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method for sandwiched antibody chip detection system based on single chain antibody fusion protein
  • Construction method for sandwiched antibody chip detection system based on single chain antibody fusion protein
  • Construction method for sandwiched antibody chip detection system based on single chain antibody fusion protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1 Construction of Single-chain Antibody Fusion Protein Z163-L-SBP and Z186-L-SBP Expression Vectors

[0057] according to figure 1 It can be known that using the upstream primer SBP15'ATATAGCGGCCGCTTCGAGCTCAGGAG3' and the downstream primer SBP25'TGACCGGATCCTGGTTCACGTTGACCTT3' to amplify the streptavidin-binding peptide (SBP) fragment (L-SBP) with a Linker (SSSGGSGSG) at the N-terminus (KEEFE A D. et al. 2001, Protein Expression and Purification, 23(3):440-446), the two ends of the double strand are respectively NotI and BamHI restriction enzyme sites. Then the double-stranded sequence was mixed with the linearized plasmid pOPE101-215 fragment cut by NotI and BamHI (Wang T. et al.2003, Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi.17(2): 116-20 ), was ligated overnight at 16°C by T4 DNA ligase, and the ligated product was the vector pOPE-L-SBP. The screened positive clones were linearized with NcoI and NotI double-enzyme digestion, and the products Z163 and...

Embodiment 2

[0058] Example 2 Construction of Single-chain Antibody Fusion Protein Z163-Fc and Z1030-Fc Expression Vectors

[0059] Cut out the Fc gene fragment from the vector pPICZaFc (Eeckhout D. et al. 2004. JImmunol Methods 294: 181-187) with BamHI and NotI, and then connect it with the same double-digested vector pOPE-215 at a molar ratio of 3:1 , with T4 DNA ligase at 16°C for overnight ligation, and the ligation product is pOPE-Fc encoding Fc.

[0060] according to figure 2 It can be seen that pCANTAB5E-Z163 and pCANTAB5E-Z1030 were double-digested with NcoI and NotI, ligated with the same double-digested vector pOPE-Fc at a molar ratio of 3:1, ligated overnight at 16°C with T4 DNA ligase, and the ligated product are pOPE-Z163-Fc and pOPE-Z1030-Fc encoding scFv and Fc.

Embodiment 3

[0061] Example 3 Construction of Sandwich Antibody Chip Based on Monoclonal Antibody and Single-chain Antibody Fusion Protein

[0062] 1. Pairing of monoclonal antibody and scFv fusion protein

[0063] according to image 3 It can be seen that a 96-well microtiter plate was coated with 1 μg / mL monoclonal antibody KG9, blocked with 4% PBSM at 37°C for 2 hours, washed three times with PBS, and added with 10 μg / mL rb-PrP c , at the same time, use 10 μg / mL TrxA as negative control, incubate at 37°C for 2h; add 25μg / mL scFv-L-SBP and scFv-Fc respectively, and incubate at 37°C for 2h; wash with PBS three times, in scFv-L-SBP In the scFv-Fc group, add streptavidin-AP conjugates, incubate at 37°C for 1 h, add 100 μL / well alkaline phosphatase substrate pNPP for color development, and measure the absorbance at 405 nm; in the scFv-Fc group, add horse antibody with HRP Human Fc antibody, incubated at 37°C for 1 h, added 100 μL / well substrate TMB to develop color, measured absorbance at ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The disclosed construction method for sandwich antibody chip detection system based on single-chain anti-body fused protein comprises: constructing the express carrier for Z186-L-SBP and Z163-L-SBP, designing upper and downstream primer, connecting double-chain ends as NotI and BamHI limited enzyme sites to the product; constructing the express carrier for Z163-Fc, and screening the single-chain antibody fused protein by ELISA method. This invention has wide application.

Description

technical field [0001] The present invention relates to the technical field of gene fusion and protein chip, and more specifically relates to a construction method of a sandwich antibody chip detection system based on a single-chain antibody fusion protein, which uses gene fusion technology to construct a single-chain antibody fusion protein for a sandwich antibody chip; Two sandwich antibody chip detection systems based on single-chain antibody fusion proteins. The mode of the system can be used not only for the detection of prions, but also for the detection of pathogens of other diseases. This mode has good application value in the field of pathogen detection. Background technique [0002] By fusing antibody molecular fragments with other proteins, antibody fusion proteins with antibody activity and other biological activities or functions can be obtained. Antibody fusion proteins can improve immune analysis, immunotherapy and antibody purification. There are two main fo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/577G01N21/64G01N33/543G01N33/68
Inventor 张先恩张吉斌周亚凤毕利军张治平汪世华陈媛媛郭永超文继开喻子牛
Owner WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com