Construction method for sandwiched antibody chip detection system based on single chain antibody fusion protein
A single-chain antibody and fusion protein technology, applied in the fields of gene fusion and protein chips, can solve the problems of expensive prion detection sensitivity, cumbersome monoclonal antibody screening and preparation, and failure to meet actual detection requirements, and achieve the effect of maintaining affinity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Example 1 Construction of Single-chain Antibody Fusion Protein Z163-L-SBP and Z186-L-SBP Expression Vectors
[0057] according to figure 1 It can be known that using the upstream primer SBP15'ATATAGCGGCCGCTTCGAGCTCAGGAG3' and the downstream primer SBP25'TGACCGGATCCTGGTTCACGTTGACCTT3' to amplify the streptavidin-binding peptide (SBP) fragment (L-SBP) with a Linker (SSSGGSGSG) at the N-terminus (KEEFE A D. et al. 2001, Protein Expression and Purification, 23(3):440-446), the two ends of the double strand are respectively NotI and BamHI restriction enzyme sites. Then the double-stranded sequence was mixed with the linearized plasmid pOPE101-215 fragment cut by NotI and BamHI (Wang T. et al.2003, Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi.17(2): 116-20 ), was ligated overnight at 16°C by T4 DNA ligase, and the ligated product was the vector pOPE-L-SBP. The screened positive clones were linearized with NcoI and NotI double-enzyme digestion, and the products Z163 and...
Embodiment 2
[0058] Example 2 Construction of Single-chain Antibody Fusion Protein Z163-Fc and Z1030-Fc Expression Vectors
[0059] Cut out the Fc gene fragment from the vector pPICZaFc (Eeckhout D. et al. 2004. JImmunol Methods 294: 181-187) with BamHI and NotI, and then connect it with the same double-digested vector pOPE-215 at a molar ratio of 3:1 , with T4 DNA ligase at 16°C for overnight ligation, and the ligation product is pOPE-Fc encoding Fc.
[0060] according to figure 2 It can be seen that pCANTAB5E-Z163 and pCANTAB5E-Z1030 were double-digested with NcoI and NotI, ligated with the same double-digested vector pOPE-Fc at a molar ratio of 3:1, ligated overnight at 16°C with T4 DNA ligase, and the ligated product are pOPE-Z163-Fc and pOPE-Z1030-Fc encoding scFv and Fc.
Embodiment 3
[0061] Example 3 Construction of Sandwich Antibody Chip Based on Monoclonal Antibody and Single-chain Antibody Fusion Protein
[0062] 1. Pairing of monoclonal antibody and scFv fusion protein
[0063] according to image 3 It can be seen that a 96-well microtiter plate was coated with 1 μg / mL monoclonal antibody KG9, blocked with 4% PBSM at 37°C for 2 hours, washed three times with PBS, and added with 10 μg / mL rb-PrP c , at the same time, use 10 μg / mL TrxA as negative control, incubate at 37°C for 2h; add 25μg / mL scFv-L-SBP and scFv-Fc respectively, and incubate at 37°C for 2h; wash with PBS three times, in scFv-L-SBP In the scFv-Fc group, add streptavidin-AP conjugates, incubate at 37°C for 1 h, add 100 μL / well alkaline phosphatase substrate pNPP for color development, and measure the absorbance at 405 nm; in the scFv-Fc group, add horse antibody with HRP Human Fc antibody, incubated at 37°C for 1 h, added 100 μL / well substrate TMB to develop color, measured absorbance at ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
