Gene of encoded cytosine deaminease for preventing and controlling crop disease

A cytosine deaminase and plant disease control technology, applied in the direction of introducing foreign genetic material, application, animal repellent, etc. by using vectors, can solve problems such as aggravating environmental pollution, drug residues, and increasing agricultural costs

Inactive Publication Date: 2007-04-25
GUANGXI UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

With the enhancement of pathogenic bacteria's resistance to drugs, the amount of pesticides is increasing, which not only aggravates environmental pollution and drug residues, but also greatly increases agricultural costs. Therefore, it is urgent to develop new strategies for disease prevention and treatment and new pollution-free drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene of encoded cytosine deaminease for preventing and controlling crop disease
  • Gene of encoded cytosine deaminease for preventing and controlling crop disease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Construction of Xanthomonas mutant library of cabbage black rot

[0027] Tn5gusA5 (Sharma, 1991) was introduced into Xcc wild-type strain 8004 using the shuttle plasmid pLAFR1 between E. Namycin) resistance marker screening Xcc::Tn5gusA5 insertion mutants, combined with Xcc whole genome sequence (genome sequence number NC 007086) and TAIL-PCR (Thermal Asymetric Interlaced-PCR) (Yao-Guang Liu, 1995) technology, to determine The insertion position of Tn5gusA5 on the genome, and the insertion position was verified by PCR. By investigating the phenotypic changes such as pathogenicity, extracellular enzyme activity, and extracellular polysaccharide synthesis of mutants, the pathogenicity-related genes are screened (Tang et.al, 2005). The present invention relates to one of the new pathogenicity-related genes- XC1949 gene (cytidine deaminase gene), its insertion mutant number is 118H11, the screening process can be found in the reference (Tang et.al, 2005).

Embodiment 2

[0028] Example 2 Cloning and sequence determination of XC1949 gene (cytosine deaminase gene)

[0029] According to the gene sequence of XC1949 (see sequence table SEQ ID No.1, base 1 to base 927), design primers (upstream primer GGGAATTCATCGCGGCGTGTTTTTGACCCC and downstream primer GGTCTAGACTCGGCGAGCACGTTCAACTGC; PCR conditions 95°C for 3min; 95°C for 30sec, 60°C for 30sec , 72°C for 1min, 30 cycles; 72°C for 5min)), using the total DNA of Xanthomonas cabbage black rot strain 8004 as a template, the full-length sequence of the gene was amplified by PCR, and cloned into the cloning vector pGEM3Zf In (+), the DNA nucleotide sequence (SEQ ID No.1) was determined on an ABI 377 DNA automatic sequencer by the dideoxynucleotide method. The correct XC1949 gene sequence verified by sequencing was cloned into the shuttle vector pLAFRJ, and the recombinant plasmid pCXC1949 containing the gene was obtained. The plasmid was digested with EcoRI and XbaI, and besides a 22kb vector band, ther...

Embodiment 3

[0030] Example 3 Verification of XC1949 Gene Insertion Mutant 118H11

[0031] The insertion mutant 118H11 was sequenced and located by TAIL-PCR, and it was found that it was inserted into the XC1949 gene. Use a primer on the gus side of transposon Tn5 (TTGTAACGCGCTTTCCCACCAACGC) and a primer (5'-GGGCAAGAGCGAAAAGCTGGACG-3') of the upstream gene XC1948 to perform PCR verification (95°C 3min; 95°C 30sec, 60°C 30sec, 72°C 45sec , 30 cycles; 72° C. for 5 min), the expected size of the product is 788 bp (see Figure 2).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a phathopoiesis related gene (cytosine deaminase gene) from Xanthomonas causing cabbage black rot. The cytosine deaminase gene provided by the invention contains one of the following nucleotide sequence: 1) DNA sequence shown in SEQ ID No.1, 2) DNA sequence containing over 80% homology with DNA sequence shown in SEQ ID No. 1. The invention also involves the application of the genes in plant disease prevention and cure, as well as the application for drug target in plant disease prevention and cure.

Description

technical field [0001] The invention relates to the field of plant disease control, more specifically, the invention relates to a gene encoding cytosine deaminase which can be used to control cabbage black rot. The present invention also relates to the application of the gene in plant disease control and as the target of medicine for plant disease control. Background technique [0002] Plant diseases have always been one of the main factors that reduce crop yield and quality. With the enhancement of pathogenic bacteria's resistance to drugs, the amount of pesticides is increasing, which not only aggravates environmental pollution and drug residues, but also greatly increases agricultural costs. Therefore, it is urgent to develop new strategies for disease prevention and treatment and new pollution-free drugs . Understanding the genetic mechanism of plant pathogens infecting hosts is the key to developing new drugs and disease control strategies. [0003] The key to the su...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/52C12N15/63C12N15/82A01N63/00
Inventor唐纪良姜伯乐梁晓夏何勇强唐东阶冯家勋陈保善
OwnerGUANGXI UNIV