Transcriptional control element of human lung carcinoma cell NGAL gene promoter region
A technology of transcriptional regulatory elements and gene promoter regions, applied in genetic engineering, plant gene improvement, recombinant DNA technology, etc., can solve the problems of unreported regulatory elements and unclear mechanism of NGA gene regulation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1 Construction of eukaryotic expression plasmids containing NGAL gene promoter region regulatory elements
[0024] 1. Cloning and sequence analysis of the 5'upstream fragment (-1695~+84) of human NGAL gene
[0025] According to the NGAL gene sequence on the NCBI database ( X99133 ), designed and synthesized six pairs of primers P1~P6 for amplifying the downstream +84 of the NGAL transcription initiation codon to different upstream sites (respectively -1431, -1137, -945, -657, -416, -152) and R, the primer sequence is as follows:
[0026] R: 5′AT AGATCT +84 GAGACCTAGGGGCATGATTT +65 3' (the underline is the BglII site, this primer is the common 3' end primer of the following 6 primers)
[0027] P1: 5′TA CTCGAG -1431 AAAGACAGTAGCAGAGGTGG -1412 3' (the underline is the XhoI site)
[0028] P2: 5′TA CTCGAG -1137 CAAGCAGCACGTAGGCAGAG -1118 3' (the underline is the XhoI site)
[0029] P3: 5′TA CTCGAG -945 GTTGAGATAACTGCTTCCCT -926 3' (the underline is...
Embodiment 2
[0054] Example 2 Activity Analysis of the Regulatory Elements in the Promoter Region of the NGAL Gene in Human Lung Cancer Cells
[0055] A. method
[0056] 1. Cell culture: lung cancer cell line 95D and A549 cells in 5% CO 2 Under the condition of 37° C., adherent growth was carried out in DMEM+HAM F12 medium (Invitrogen Company), and the cells were digested and passaged with 0.25% trypsin and 0.02% EDTA cell digestion solution.
[0057] 2. Transient transfection: Qiagen Plasmid Midi Kit (QIAGEN Company) was used to extract the experimental plasmid to be transfected, the control plasmid pGL3-Basic (Promega Company) and the internal reference plasmid pRL-TK (Promega Company), and their content and purity were determined. Dilute the experimental plasmid and control plasmid expressing firefly luciferase to 100ng / μl with Buffer EB (10mM Tris Cl, pH8.5), and dilute the internal reference plasmid pRL-TK expressing Renilla luciferase to 100ng / μl with Buffer EB. 20ng / μl. The exper...
Embodiment 3
[0066] Example 3 Demonstration of key regulatory elements in the promoter region of the NGAL gene in human lung cancer cells
[0067] A. method
[0068] 1. Extract nucleoprotein: ①Lung cancer cell line 95D and A549 cells are conventionally subcultured. After they grow into a single layer, wash them twice with 1×PBS, and then use cell digestion solution containing 0.25% trypsin and 0.02% EDTA Cells were digested and harvested individually into 15 ml centrifuge tubes. Then wash 3 times with 1×PBS, centrifuge at room temperature at 250g for 10min each time, and discard the supernatant. ② Add 5 times the volume of pre-cooled cell homogenization buffer to resuspend the cell pellet. After 10 minutes in ice bath, centrifuge at 250g for 10 minutes at 4°C. ③Discard the supernatant, add 3 times the volume of pre-cooled cell homogenization buffer containing 0.05% NP-40 to resuspend the cell pellet, and homogenize up and down 20 times with the compact mallet of the Dounce homogenizer (o...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 