Transcriptional control element of human lung carcinoma cell NGAL gene promoter region

A technology of transcriptional regulatory elements and gene promoter regions, applied in genetic engineering, plant gene improvement, recombinant DNA technology, etc., can solve the problems of unreported regulatory elements and unclear mechanism of NGA gene regulation

Inactive Publication Date: 2007-06-06
SHANTOU UNIV MEDICAL COLLEGE
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, people mainly focus on the research on the function of NGAL protein, and the mechanism of the upstream transcription and expression regulation of NGA gene is still unclear.
When Cowland studied the induced expression of NGAL by IL-1β in the lung cancer cell line A549, he proposed that there may be a cis-acting element that plays a key role in the regulation of gene expression in the interval between -153 and -90 upstream of the 5' end of the NGAL gene. Specific regulatory elements have not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transcriptional control element of human lung carcinoma cell NGAL gene promoter region
  • Transcriptional control element of human lung carcinoma cell NGAL gene promoter region
  • Transcriptional control element of human lung carcinoma cell NGAL gene promoter region

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Construction of eukaryotic expression plasmids containing NGAL gene promoter region regulatory elements

[0024] 1. Cloning and sequence analysis of the 5'upstream fragment (-1695~+84) of human NGAL gene

[0025] According to the NGAL gene sequence on the NCBI database ( X99133 ), designed and synthesized six pairs of primers P1~P6 for amplifying the downstream +84 of the NGAL transcription initiation codon to different upstream sites (respectively -1431, -1137, -945, -657, -416, -152) and R, the primer sequence is as follows:

[0026] R: 5′AT AGATCT +84 GAGACCTAGGGGCATGATTT +65 3' (the underline is the BglII site, this primer is the common 3' end primer of the following 6 primers)

[0027] P1: 5′TA CTCGAG -1431 AAAGACAGTAGCAGAGGTGG -1412 3' (the underline is the XhoI site)

[0028] P2: 5′TA CTCGAG -1137 CAAGCAGCACGTAGGCAGAG -1118 3' (the underline is the XhoI site)

[0029] P3: 5′TA CTCGAG -945 GTTGAGATAACTGCTTCCCT -926 3' (the underline is...

Embodiment 2

[0054] Example 2 Activity Analysis of the Regulatory Elements in the Promoter Region of the NGAL Gene in Human Lung Cancer Cells

[0055] A. method

[0056] 1. Cell culture: lung cancer cell line 95D and A549 cells in 5% CO 2 Under the condition of 37° C., adherent growth was carried out in DMEM+HAM F12 medium (Invitrogen Company), and the cells were digested and passaged with 0.25% trypsin and 0.02% EDTA cell digestion solution.

[0057] 2. Transient transfection: Qiagen Plasmid Midi Kit (QIAGEN Company) was used to extract the experimental plasmid to be transfected, the control plasmid pGL3-Basic (Promega Company) and the internal reference plasmid pRL-TK (Promega Company), and their content and purity were determined. Dilute the experimental plasmid and control plasmid expressing firefly luciferase to 100ng / μl with Buffer EB (10mM Tris Cl, pH8.5), and dilute the internal reference plasmid pRL-TK expressing Renilla luciferase to 100ng / μl with Buffer EB. 20ng / μl. The exper...

Embodiment 3

[0066] Example 3 Demonstration of key regulatory elements in the promoter region of the NGAL gene in human lung cancer cells

[0067] A. method

[0068] 1. Extract nucleoprotein: ①Lung cancer cell line 95D and A549 cells are conventionally subcultured. After they grow into a single layer, wash them twice with 1×PBS, and then use cell digestion solution containing 0.25% trypsin and 0.02% EDTA Cells were digested and harvested individually into 15 ml centrifuge tubes. Then wash 3 times with 1×PBS, centrifuge at room temperature at 250g for 10min each time, and discard the supernatant. ② Add 5 times the volume of pre-cooled cell homogenization buffer to resuspend the cell pellet. After 10 minutes in ice bath, centrifuge at 250g for 10 minutes at 4°C. ③Discard the supernatant, add 3 times the volume of pre-cooled cell homogenization buffer containing 0.05% NP-40 to resuspend the cell pellet, and homogenize up and down 20 times with the compact mallet of the Dounce homogenizer (o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to gene expression controlling technology, and discloses one kind of transcriptional control element of human lung carcinoma cell NGAL gene promoter region. The present invention identifies human lung carcinoma cell NGAL gene promoter region for the first time, inserts the promoter sequence with gradually deleting 5' end sequence and partial modified controlling element to the upstream of the report gene to constitute serial eukaryotic expression plasmids, transfects mammal cell for instantaneous expression, and determines the key control element of human NGAL gene promoter in lung carcinoma cell transcription activity. The present invention is significant in the research of NGAL in the tumor cell expression control mechanism and NGAL targeting clinical treatment.

Description

technical field [0001] The present invention relates to regulation of gene expression, in particular to a transcription regulation element of the NGAL gene promoter region of human lung cancer cells. Background technique [0002] Lung cancer, also known as primary bronchial carcinoma, is a common malignant tumor of the lung. In the world, the morbidity and mortality of lung cancer rank first among cancers. Moreover, the morbidity and mortality of lung cancer are showing a continuous upward trend all over the world. There are no obvious symptoms in the early stage of lung cancer, and most of the patients who seek medical treatment due to symptoms are in the middle and late stages. These are important reasons for the high mortality rate of lung cancer. At present, the pathogenesis of lung cancer is still unclear. Studies have found that NGAL gene is highly expressed in many tumor cells including lung cancer cells; our recent research results show that NGAL gene is highly co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N15/63C12N15/85
Inventor 李恩民常静霞许丽艳袁华敏王子良
Owner SHANTOU UNIV MEDICAL COLLEGE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap