Unlock instant, AI-driven research and patent intelligence for your innovation.

Alphavirus vectors for paramyxovirus vaccines

a technology of paramyxovirus and betavirus, which is applied in the field of betavirus vectors for paramyxovirus vaccines, can solve the problems of imbalance in cell-mediated responses, inability to fully adapt to large-scale vaccine production, and inability to provide vaccines, etc., and achieves low dose, less time, and high anti-f igg antibody

Inactive Publication Date: 2003-09-25
AVENTIS PASTEUR LTD
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The vaccine induces a high anti-F IgG antibody titre and provides protection against RSV infection, offering improved immune response with lower doses and shorter administration times compared to previous approaches, without causing disease enhancement.

Problems solved by technology

However, such a vaccine is Still not available.
Recent experimental evidence suggests that an imbalance in cell-mediated responses may contribute to immunopotentiation.
However, neither of these techniques may be entirely suitable for Large scale production of vaccines under all circumstances.
Infection with RSV leads to serious disease.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alphavirus vectors for paramyxovirus vaccines
  • Alphavirus vectors for paramyxovirus vaccines
  • Alphavirus vectors for paramyxovirus vaccines

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0062] EXAMPLE 1

[0063] This Example describes a scheme for construction of a Semliki Forest Virus (SFV) DNA expression vector containing a truncated RSV F gene as outlined in FIGS. 1A to 1B.

[0064] Plasmid VR1012 was restricted with PstI and then made blunt-ended with T4 DNA polymerase. The .beta.-globin intron II was exised out of vector pSG5 (Stratagene) and ligated into plasmid VR1012 to generate plasmid pIIE. Plasmid pIIE was then restricted with SalI and EcoRV and ligated to a PCR fragment having the nucleotide sequence:

2 (Seq ID no:7) TCGACATGGCGGATGTGTGACATACACGACGCCAAMGATTTTG-TTCCAGC TCCTGCCACCTCCGCTACGCGAGAGATTAACCACCCACGATGGCCGCCA-A AGTGCATGTTGATATTGAGGCTGACAGCCCATTCATCAAAGTCTTTGCAG AAGGCATTTCCGTCGTTCGAGGTTCGAGTCATTGCAGGTCACACCAAATG ACCATGCAAATGCCAGAGCATTTTCGCACCTGGCTACCAAATTGATCGAG CAGGAGACTGACAAAGACACACTCATCTTGGAT

[0065] generated from pSFVI with primers SAL-SFV having the nucleotide The resulting plasmid pMP38 was then restricted with EcoRV-TCCACCTCCAAGATATCC-AAGATGAGTGTG...

example 2

[0067] EXAMPLE 2

[0068] This Example describes an alternative scheme for constructing plasmid pMp44 as outlined in FIG. 2.

[0069] Plasmid VR1012 was restricted with PstI and then made blunt-ended with T4 DNA polymerase. The .beta.-globin Intron II was exised out of vector pSG5 (Stratagene) and ligated into plasmid VR1012 to generate plasmid pIIE. Plasmid pIIE was then restricted with SalI and EcoRV and ligated to a PCR fragment having the nucleotide sequence:

3 (SEQ ID no: 7) TCGACATGGCGGATGTGTGACATACACGACGCCAAAAGATTT-TGTTCCAG CTCCTGCCACCTCCGCTACGCGAGAGATTAACCACCCACGATGGCCGC-CA AAGTGCATGTTGATATTGAGGCTGACAGCCCATTCATCAAGTCTTTGCAG AAGGCATTTCCGTCGTTCGAGGTGGAGTCATTGCAGGTCACACCAAATGA CCATGCAAATGCCAGAGCATTTTCGCACCTGGCTACCAAATTGATCGAGC AGGAGACTGACAAAGACACACTCATCTTGGAT

[0070] generated from pSFVI with primers SAL-SFV having the nucleotide sequence 5'-TCCACCTCCAAGATATCCAAGATGAGTGTG (SEQ ID no: 5) and ECO-SFV having the nucleotide sequence 5'- TCCACCTCCAAG-ATATCCAAGATGAGTGTG (SEQ ID no: 6). The re...

example 3

[0072] EXAMPLE 3

[0073] This Example describes the immunization of mice with pMP44 and the immunogenicity results obtained. BALB / C mice were immunized with plasmid pMP44 by the intramuscular (i.m.) route. The anterior tibialts muscles of six BALB / C mice were bilaterally injected with 2.times.100 .mu.g of plasmid pMP44 This amount is equivalent to approximately 94 .mu.g of a conventional vector, based on copy number. These mice were boosted in an identical manner 4 weeks later. The control group was immunized with 2 .times.25 .mu.g of SFV-RSV F RNA as described in my aforementioned U.S. application Ser. No. 08 / 923,558, except that the muscles were not pre-treated with cardiotoxin. The immunization protocol is set forth in the following Table I:

4TABLE 1 Immunization protocol Route of Route of Group Prime Inoculation Boost Inoculation 1 SFV-RSVF RNA.sup.1 Intramuscular SFV-RSVF RNA.sup.1 Intramuscular 2 pMP44 DNA.sup.2 Intramuscular pMP44DNA.sup.2 Intramuscular

[0074] Mice were inoculate...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
temperaturesaaaaaaaaaa
length RSVaaaaaaaaaa
resistanceaaaaaaaaaa
Login to View More

Abstract

In summary of this disclosure, the present invention provides certain novel alphavirus derived DNA vectors containing genes encoding RSV F or RSV G proteins, or other paramyxovirus proteins, methods of immunization using such vectors and methods of diagnosis using such vectors. Modifications are possible within the scope of this invention.

Description

[0001] The present invention relates to the field of paramyxoviridae vaccines and is particularly concerned with vaccines comprising DNA encoding the fusion (F) protein of respiratory syncytial virus (RSV) in an alphavirus vector.[0002] Human respiratory syncytial virus (RSV) has been identified as a major pathogen responsible for severe respiratory tract infections in infants, young children and the institutionalized elderly (refs. 1,2,3,4--throughout this application, various references are cited in parentheses to describe more fully the state of the art to which this invention pertains. Full bibliographic information for each citation is found at the end of the specification, immediately preceding the claims. The disclosures of these references are hereby incorporated by reference into the present disclosure). Global mortality and morbidity figures indicate that there is an urgent need for an efficacious RSV vaccine (refs. 5,6). In the USA alone, approximately 100,000 children ar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12N15/09A61K31/711A61K39/155A61P31/12C07K14/115C07K14/135C12N15/45C12N15/86
CPCA61K2039/51A61K2039/5256A61K2039/53C07K14/005C12N2830/42C12N2760/18522C12N2760/18622C12N2770/36143C12N15/86A61P31/12
Inventor PARRINGTON, MARKLI, XIAMAOKLEIN, MICHEL H.
Owner AVENTIS PASTEUR LTD