Chlamydia antigens and corresponding DNA fragments and uses thereof
a technology of chlamydia omp and antigen, which is applied in the field of chlamydia omp p6 precursor and corresponding dna molecules, can solve the problems of slow recovery, ineffective vaccine for human chlamydia infection, and low safety of vaccines
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
[0143] This example illustrates the preparation of plasmid vector pCABk831 containing the omp P6 precursor gene.
[0144] The omp P6 precursor gene (SEQ ID No:1) was amplified from Chlamydia pneumoniae genomic DNA by polymerase chain reaction (PCR) using a 5′ primer (5′ ATAAGAATGCGGCCGCCACCATGAATATACATTCCCTATGGAAAC 3′; SEQ ID No:3) and a 3′ primer (5′ GCGCCGGATCCCGCGTGCATGAATCTTAAACTCTGTACGGC 3′; SEQ ID No:4). The 5′ primer contains a NotI restriction site, a ribosome binding site, an initiation codon and a sequence at the 5′ end of the omp P6 precursor coding sequence. The 3′ primer includes the sequence encoding the C-terminal sequence of the omp P6 precursor gene and a BamHI restriction site. The stop codon was excluded and an additional nucleotide was inserted to obtain an in-frame fusion with the Histidine tag.
[0145] After amplification, the PCR fragment was purified using QIAquick™ PCR purification kit (Qiagen), digested with NotI and BamHI and cloned into the pCA-Myc-His eukar...
example 2
[0146] This example illustrates the preparation of the eukaryotic expression vector pCA / Myc-His.
[0147] Plasmid pcDNA3.1(−)Myc-His C (Invitrogen) was restricted with SpeI and BamHI to remove the CMV promoter and the remaining vector fragment was isolated. The CMV promoter and intron A from plasmid VR-1012 (Vical) was isolated on a SpeI / BamHI fragment. The fragments were ligated together to produce plasmid pCA / Myc-His. The NotI / BamHI restricted PCR fragment containing the omp P6 precursor gene (SEQ ID No:1) was ligated into the NotI and BamHI restricted plasmid pCA / Myc-His to produce plasmid pCABk831 (FIG. 3).
[0148] The resulting plasmid, pCABk831, was transferred by electroporation into E. coli XL-1 blue (Stratagene) which was grown in LB broth containing 50 μg / ml carbenicillin. The plasmid was isolated by the Endo Free Plasmid Giga Kit™ (Qiagen) large scale DNA purification system. DNA concentration was determined by absorbance at 260 nm and the plasmid was verified after gel elec...
example 3
[0149] This example illustrates the immunization of mice to achieve protection against an intranasal challenge of C. pneumoniae.
[0150] It has been previously demonstrated (Yang et al. Infect. Immun. May 1993. 61(5):2037-40) that mice are susceptible to intranasal infection with different isolates of C. pneumoniae. Strain AR-39 (Grayston et al (1990) Journal of Infectious Diseases 161:618-625) was used in Balb / c mice as a challenge infection model to examine the capacity of Chlamydia gene products delivered as naked DNA to elicit a protective response against a sublethal C. pneumoniae lung infection. Protective immunity is defined as an accelerated clearance of pulmonary infection.
[0151] Groups of 7 to 9 week old male Balb / c mice (8 to 10 per group) were immunized intramuscularly (i.m.) plus intranasally (i.n.) with plasmid DNA containing the C. pneumoniae omp P6 precursor gene as described in Examples 1 and 2. Saline or the plasmid vector lacking an inserted Chlamydial gene was gi...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Tm | aaaaa | aaaaa |
| temperature | aaaaa | aaaaa |
| temperatures | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


