Vibrio cholerae strains VCUSM1 and VCUSM4, method of producing same, and vaccine derivatives thereof

a technology of cholerae and vcusm4, which is applied in the field ofvibrio cholerae strains, can solve the problems of vaccine strains that cannot synthesize aminolevulinic acid (ala) de, and cannot survive in environmental waters such as sea, river and sewage, and achieve good colonization ability, good safety properties, and limited in vitro and in vivo growth.

Inactive Publication Date: 2006-05-11
UNIVERSITI SAINS MALAYSIA
View PDF7 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0040] The present invention relates to Vibrio cholerae strains, VCUSM1 (O139) and VCUSM4 (El Tor). This vaccine strains has been mutated in the hemA gene (for VCUSM1). The hemA gene VCUSM4 is mutated by frame shift mutation. Both the strains are not capable of synthesizing aminolevulinic acid (ALA) de novo. The strains are obtained from a parent strain originally isolated from a patient's coproculture having all the identifying characteristics of Vibrio cholerae 0139 synonym Bengal as comma-shape, highly motile, Gram negative, optimal growth at Ph of 6-9, agglutinable with anti 0139 antisera, non-agglutinable with anti O1 antisera, has intact genes of ctx, ace and zot and produces functional cholera toxin, accessory cholera enterotoxin and zonula occludes toxin. The mutation was carried out by inserting a kanamycin resistance gene (kanR) cassette in the hemA gene. These hemA mutants grow only in the presence of amino levulenic acid (ALA) and have limited in vitro and in vivo growth in the absence of ALA. VCUSM1 and VCUSM4 strains have been tested for their colonization ability in the infant mouse model. Their colonization ability was good and was similar as that of wild type V. cholerae. The protective efficacy of the VCUSM1 and VCUSM4 strains were tested in the RITARD (removable intestinal tie-adult rabbit diarrhea) model. All of the vaccinated rabbits survived with no symptoms of diarrhea after challenge with virulent Vibrio cholerae, whereas 100% mortality was observed in unvaccinated (control) rabbits within 18 hours post challenge. The vaccine strains also did not survive in environmental waters like the sea, river and sewage when compared to wild type V. cholerae. These results indicate that the VCUSM1 and VCUSM4 do not survive in the environment; hence they have good safety properties. The strains developed in the present invention offers a way to develop vaccines for cholera caused by V. cholerae O139 and O1 serotype and El Tor biotype.

Problems solved by technology

Both the strains are not capable of synthesizing aminolevulinic acid (ALA) de novo.
The vaccine strains also did not survive in environmental waters like the sea, river and sewage when compared to wild type V. cholerae.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vibrio cholerae strains VCUSM1 and VCUSM4, method of producing same, and vaccine derivatives thereof
  • Vibrio cholerae strains VCUSM1 and VCUSM4, method of producing same, and vaccine derivatives thereof
  • Vibrio cholerae strains VCUSM1 and VCUSM4, method of producing same, and vaccine derivatives thereof

Examples

Experimental program
Comparison scheme
Effect test

examples

(METHODOLOGY)

Construction of VCUSM1 Strain

[0078] For the first time in the literature, the hemA gene, which encodes glutamyl t-RNA reductase has been isolated and cloned by the inventors (Seq. ID No. 1). The hemA gene plays a major rate-limiting step in δ-Aminolevulinic acid (ALA) synthesis. Since ALA is essential for tetrapyrrole biosynthesis, mutation of hemA gene in V. cholerae leads to depletion of ALA, which in turn leads to limited growth in normal in-vitro and in vivo condition.

[0079] The hemA / M gene was amplified using polymerase chain reaction (PCR) using a forward primer VHF 5′ GACCTGTGATGTAAAGGAAC 3′ (Seq. ID No.4) and a reverse primer VHR 5′ CTTCATAGCGCTCAACAAGG 3′ (Seq. ID No.5). The PCR conditions were 95° C. for 3 minutes, 95° C. for 30 seconds, 58° C. for 30 seconds, 72° C. for 45 seconds. 72° C. for 5 minutes. Total numbers of cycles were 30. Wild type O139 bacterial lysate was used as template for PCR.

[0080] A 2180 bp PCR product (Seq. ID No.1) was expected. Th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
pHaaaaaaaaaa
volumeaaaaaaaaaa
Login to view more

Abstract

Metabolic auxotroph of Vibrio cholerae 0139 synonym Bengal which has a mutation in its hem A gene and which is not capable of synthesizing aminolevulinic acid (ALA) de novo and which is obtained from a parent strain originally isolated from a patient's coproculture having all the identifying characteristics of Vibrio cholerae 0139 synonym Bengal is described. In this strain the hem A gene is mutated by inserting a kanamycin resistant gene cassette. Another metabolic auxotroph of Vibrio cholerae 01 El Tor where the hem A gene is mutated by a frame shift mutation is disclosed. Methods of producing the strains are disclosed.

Description

FIELD OF INVENTION [0001] The present invention relates to two Vibrio cholerae strains, VCUSM1 (O139) and VCUSM4 (El Tor) that have been mutated in the hemA gene. The present invention further relates to methods for developing VCUSM1 (O139) strain and VCUSM4 (El Tor). BACKGROUND OF THE INVENTION Introduction [0002] Cholera can be defined as a sudden onset of watery diarrhea often accompanied by vomiting and resulting in hypovolemic shock and acidosis. Cholera is caused by certain members of the species Vibrio cholerae which reside in the small intestine and secrete cholera toxins. [0003]Vibrio cholerae strains are natural inhabitants of brackish water and estuarine systems where they may constitute the normal microflora of zooplankton and shellfish. Vibrio cholerae is the type species of the genus Vibrio that belongs to the family Vibrionaceae. Vibrio cholerae are facultative anaerobe, highly motile and slightly curved non-sporing, gram negative rods measuring 1.4 to 2.6 μm in lengt...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(United States)
IPC IPC(8): A61K39/106C12N1/20
CPCA61K39/107A61K2039/522A61K2039/542C07K14/28A61P31/04Y02A50/30
Inventor RAVICHANDRAN, MANICKAMALI, SYEDRASHID, NURPATTABIRAMAN, LALITHAZAINUDDIN, ZAINUL
Owner UNIVERSITI SAINS MALAYSIA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap