Method for weakening hemB gene expression to increase yield of 5-aminolevulinic acid synthesized by escherichia coli

A technology of aminolevulinic acid and Escherichia coli, applied in the fields of metabolic engineering and microbial fermentation, can solve problems such as high cost, unsuitability for large-scale industrial production, etc., and achieve the effect of increasing yield

Active Publication Date: 2015-08-12
JIANGNAN UNIV
View PDF4 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the particularity of photosynthetic bacteria, their cost is high and they are not suitable for large-scale industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for weakening hemB gene expression to increase yield of 5-aminolevulinic acid synthesized by escherichia coli
  • Method for weakening hemB gene expression to increase yield of 5-aminolevulinic acid synthesized by escherichia coli
  • Method for weakening hemB gene expression to increase yield of 5-aminolevulinic acid synthesized by escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Assembly of Homologous Recombination Fragment P1-Kan-PfliC-P2

[0035] Using the Escherichia coli genome as a template, the upstream homology arm P1 (934bp), the downstream homology arm P2 (726bp) and the fliC promoter PfliC (130bp) of the hemB gene promoter were respectively amplified, and the plasmid pKD13 was used as a template to amplify the selection marker anti- Sex gene Kan (1330bp). Then, four fragments were assembled by fusion PCR method, that is, P1-Kan-PfliC-P2 (3120bp).

[0036] Primers are as follows:

[0037] upstream homology arm P1

[0038] F1: CACTTGTATCAAATGTCTCATTTGTGTG

[0039] R1: CGAAGCAGCTCCAGCCTACACTTATTTATAGCTGTTGGTTATTATTTTTTGG

[0040] resistance gene Kan

[0041] F2: TAACCAACAGCTATAAATAAGTGTAGGCTGGAGCTGCTTCG

[0042] R2: TTTCAAAAACAGCCATTTTTTGATAAGCTGTCAAACATGAGAATTAATT

[0043] PromoterPfliC

[0044] F3: TCATGTTTGACAGCTTATCAAAAAATGGCTGTTTTTGAAAAAAATT

[0045] R3: CGTTGGATTAAGTCTGTCATGATTCGTTATTCCTATATTGCAAGTC

[0046] dow...

Embodiment 2

[0049] Example 2 HemB Gene Promoter Transformation

[0050] The promoter transformation method uses the Red recombination one-step knockout method:

[0051] (1) The plasmid pKD46 was transformed into E.coli BL21(DE3). The plasmid was temperature-sensitive, and the cell culture temperature was 30°C. Pick a single colony cultured in the slant medium and inoculate it in the SOB medium supplemented with 100mg / L ampicillin. After culturing overnight at 30°C for about 12 hours, transfer it to SOB culture supplemented with 100mg / L ampicillin at 2% inoculum Continue culturing in medium until OD600nm is about 0.1-0.2, add L-arabinose at a final concentration of 10mM to induce the expression of the recombinant enzyme, continue culturing until OD600nm is about 0.6, and bathe the bacterial solution in ice for about 10min. Centrifuge at 4000r / min for 10min at 4°C to collect the bacterial cells, then wash the bacterial cells three times with sterile 10% glycerol aqueous solution, concentra...

Embodiment 3

[0055] Embodiment 3 Recombinant bacteria fermentation verification

[0056] Strains:

[0057] LADF-6: E. coli BL21(DE3) / pRSFDuet-1-hemLA-hemFpETDuet-1-hemD.

[0058] PfliC-LADF-6:E.coli BL21(DE3)PfliC / pRSFDuet-1-hemLA-hemF pETDuet-1-hemD.

[0059] Recombinant Escherichia coli PfliC-LADF-6 and control bacterium LADF-6 were respectively fermented in 250mL Erlenmeyer flasks, the inoculum size was 1%, the initial glucose concentration was 20g / L, 0h added 0.1-0.5mM IPTG induction and ampicillin (100mg / L ) and kanamycin (50mg / L), ALA began to accumulate in large quantities after 10h, and the output was the highest at about 30h, which was 2680mg / L, which was increased by more than 25% compared with the control output ( image 3 a).

[0060] Recombinant Escherichia coli PfliC-LADF-6 was scaled up in a 3L fermenter with an inoculum size of 2% and an initial glucose concentration of about 35g / L. 0h was added with 0.1-0.5mM IPTG for induction and ampicillin (100mg / L) and kana Mycin (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for weakening hemB gene expression to increase yield of 5-aminolevulinic acid synthesized by escherichia coli and belongs to the field of and microorganism fermentation. On the basis of using carrier pRSFDuet-1 overexpression glutamy-tRNA reductase, pancreatic aldehyde amino transferase, coproporphyrinogen III oxidase and carrier pETDuet-1 overexpression urinary porphyrins III synthase, a promoter of hemB genes is horizontally transformed in a gene group so as to control expression of the hemB genes and surveying influence, on ALA accumulation, of the hemB genes. Shake-flask fermentation verifies that yield of a target product ALA is increased remarkably, and the ALA yield at 30h is 2680mg / L.

Description

technical field [0001] The invention relates to a method for weakening the expression of hemB gene and improving the synthesis of 5-aminolevulinic acid by Escherichia coli, belonging to the fields of metabolic engineering and microbial fermentation. Background technique [0002] 5-aminolevulinic acid (5-aminolevulinic acid, ALA), the molecular formula is C 5 o 3 NH 9 , with a molecular weight of 131.13 and a melting point of 149-151°C, it is the biosynthesis of chlorophyll, heme, and vitamin B 12 and other key precursors. ALA has been widely used in the fields of medicine and agriculture. As a safe, selective, and permeable photodynamic drug, it has been successfully used in the diagnosis and photodynamic therapy of skin cancer, bladder cancer, digestive tract cancer, and lung cancer. In addition, because ALA is degradable in nature, it is also widely used in the field of pesticides as a new type of pollution-free photoactivated pesticide, herbicide and plant growth regu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12P13/00
Inventor康振张俊丽陈坚堵国成
OwnerJIANGNAN UNIV