Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Purified active HCV NS2/3 protease

a technology of hepatitis c virus and ns2/3, which is applied in the direction of peptides, chemical treatment enzyme inactivation, enzymology, etc., to achieve the effect of promoting autocleavage and reducing difficulties and disadvantages

Inactive Publication Date: 2007-07-26
BOEHRINGER INGELHEIM CANADA LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

"The present invention provides a novel method for purifying and activating HCV NS2 / 3 protease, which is a key enzyme in the hepatitis C virus lifecycle. The method solubilizes the protease and refolds it under conditions that will not promote autocleavage. Additionally, the invention produces a high level of a N-terminal truncated form of NS2 / 3 protease in inclusion bodies using recombinant methods. This allows for large amounts of the protease to be isolated and purified. The invention also provides a method for assaying the activity of NS2 / 3 protease and screening a candidate drug or ligand that inhibits its activity. The refolded inactive NS2 / 3 protease and its truncation variants described in this patent have been found to be stable at room temperature without proceeding to auto-catalysis."

Problems solved by technology

Advantageously, this method both solubilizes the protease and refolds it under conditions that will not promote autocleavage of the protease.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Purified active HCV NS2/3 protease
  • Purified active HCV NS2/3 protease
  • Purified active HCV NS2/3 protease

Examples

Experimental program
Comparison scheme
Effect test

example 1

NS2 / 3 Full Length Construct:

[0156] The full length (810-1206) NS2 / 3 sequence was amplified by PCR from the HCV 1b-40 sequence (WO 99 / 07733 by Boehringer-Ingelheim (Canada), Ltd.) using two oligonucleotide primers, 5′-CCATGGACCGGGAGATGGCT-3′ (SEQ ID NO: 5) for the N-terminus and 5′GGATCCTTAACCACCGAACTGCGGGTGACGCCAAGCGCTACTAGTCCGCAT GGTAGTTTCCAT-3′ (SEQ ID NO: 6) for the C-terminus. This procedure introduces a NcoI site at the 5′ end and a streptavidin tag “st” (Schmidt & Skerra, Prot. Engineering (1993) 6; 109-122) followed by a BamH1 site at the 3′ end giving a nucleic acid molecule of SEQ ID NO:1 (FIG. 1). The PCR product was inserted into the vector pCR™ 3 using the TA cloning® kit from Invitrogen. The insert was then transferred to a bacterial expression vector pET-11d (Novagen) by cutting with EcoRI followed by Klenow treatment to create blunt ends followed by a partial digestion with NcoI. This construct was designated pET-11d-NS2 / 3st. The DNA was transformed into XL-1 Blue E...

example 2

NS2 / 3 N-terminal Deletion Mutants

[0157] The N-terminal deletion mutants 815*-1206, 827-1206, 855-1206, 866-1206, 904-1206 and 915-1206 were derived from the pET-11d / NS2 / 3 template that was designed with a NcoI site at the 5′ end and within the NS3 domain at amino acid 1083. Following the template digestion with NcoI, the 3′ end fragment and the vector were gel purified. The mutants were obtained by PCR using the appropriate synthetic oligonucleotides primers containing the NS2 / 3 sequence from nucleotides that encode the desired N-terminal residue up to amino acid 1083. The primers also introduced a NcoI site at the 5′ end, such that the resulting inserts could be ligated to the gel purified fragment. The DNA was then transformed into E. coli XL-Blue cells, isolated and sequenced. Finally, the DNA was transferred into E. coli BL21(DE3)pLysS for protein production. Expression was verified by SDS-PAGE (FIG. 2A, 2B, 2C).

* The numbering of this fragment is erroneous since the first me...

example 3

NS2 / 3 N-terminal Truncation Mutant 4K-6H (904-1206)st-4K (SEQ ID NO: 4):

[0158] In this construct, four lysines were added at the N- and C-termini as well as a hexahistidine tag at the N-terminus. This construct was obtained using PCR and the pET-11d / NS2 / 3st template with two primers containing the sequence for the tags as well as the NS2 / 3 sequence from nucleotides that encode amino acid residues 904-1206. The primers also introduced a NdeI and BamHI site at 5′ and 3′ end respectively. The insert was cloned into pET-11d and designated pET-11d 4K-6H-NS2 / 3 (904-1206)-st-4K (SEQ ID NO:3). The DNA was transformed into E. coli XL-1 Blue cells, isolated and sequenced. The DNA was then transferred into E. coli BL21 (DE3) pLysS for protein production.

[0159] For the truncated construct 904-1206, 4 primers and 2 successive PCR reactions were used. The primers used in the first PCR reaction were GCTCGAGCATCACCATCACCATCACACTAGTGCAGGCATAACCAAA (SEQ ID NO:7) for the N-terminus and AACAATGGATCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
pHaaaaaaaaaa
pHaaaaaaaaaa
pHaaaaaaaaaa
Login to View More

Abstract

A method for producing a refolded, inactive form of recombinantly produced NS2 / 3 protease which comprises the steps of: a) purifying the protease from inclusion bodies in the presence of a chaotropic agent; and b) refolding the purified protease by contacting it with a reducing agent and lauryldiethylamine oxide (LDAO) in the presence of reduced concentration of chaotropic agent or polar additive. The invention further comprises a method for activating this refolded inactive NS2 / 3 protease by adding an activation detergent. This method produces large amounts of the active NS2 / 3 protease to allow small molecules and ligands to be screened as potential inhibitors of NS2 / 3 protease, which may be useful as therapeutic agents against HCV.

Description

RELATED APPLICATIONS [0001] This application is a divisional of U.S. application Ser. No. 10 / 017,736, filed Dec. 14, 2001, which claims, as does the present application priority to U.S. Provisional Application Ser. No. 60 / 256,031, filed on Dec. 15, 2000, the disclosures of all of which are incorporated by reference in their entirety.FIELD OF THE INVENTION [0002] The invention relates generally to purification and activation methods for Hepatitis C virus (HCV) NS2 / 3 protease, particularly to a method of producing a refolded, inactive NS2 / 3 protease or truncations thereof which can later be activated for auto-cleavage. More particularly, the method provides for truncated, purified active HCV NS2 / 3 protease and assays for identifying inhibitors thereof. BACKGROUND OF THE INVENTION [0003] Hepatitis C Virus (HCV) is an important cause of chronic liver disease leading to cirrhosis and end-stage liver disease in humans. Over 150 million people worldwide are persistently infected with HCV a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12N9/99C12N9/48C07K7/08G01N33/50C07K14/18C12N5/02C12N7/01C12N9/50C12N15/50C12N15/57C12Q1/37G01N33/15G01N33/68
CPCC07K14/005C12N9/506C12N2770/24222G01N2500/04G01N33/6893G01N2333/18G01N2500/00C12Q1/37
Inventor THIBEAULT, DIANELAMARRE, DANIELMAURICE, ROGERPILOTE, LOUISEPAUSE, ARMIN
Owner BOEHRINGER INGELHEIM CANADA LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com