Production of commercial biodiesel from genetically modified microorganisms

a technology of genetically modified microorganisms and biodiesel, which is applied in the direction of biofuels, fermentation, biofeedstock, etc., to achieve the effects of low impurities and/or undesirable contaminants, and clean emissions profiles

Inactive Publication Date: 2010-10-14
GENOMATICA INC +1
View PDF35 Cites 45 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0023]The invention provides a fermentation and recovery process for the production of biodiesel of commercial grade quality according to commercial standards (e.g., ASTM or ANP) as well as environmental standards (e.g., those promulgated by the United States Environmental Protection Agency (EPA), and similar agencies elsewhere) by fermentation of carbohydrates using a genetically modified microorganism. The process provides a direct route for the production of fatty esters, for example fatty acid esters, and especially fatty acid methyl esters, without the need for producing oils which are later chemically transesterified with the concomitant production of large quantities of glycerol. The biodiesels produced, alone or blended with petroleum diesel according to customary proportions, result in clean emissions profiles and low amounts of impurities and / or undesirable contaminants.

Problems solved by technology

The biodiesels produced, alone or blended with petroleum diesel according to customary proportions, result in clean emissions profiles and low amounts of impurities and / or undesirable contaminants.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Production of commercial biodiesel from genetically modified microorganisms
  • Production of commercial biodiesel from genetically modified microorganisms
  • Production of commercial biodiesel from genetically modified microorganisms

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0314]This example describes the construction of a genetically engineered microorganism wherein the expression of a fatty acid degradation enzyme is attenuated.

[0315]The fadE gene of E. coli MG1655 (an E. coli K strain) was deleted using the Lambda Red system described in Datsenko et al., Proc. Natl. Acad. Sci. USA 97: 6640-6645 (2000), with the following modifications.

[0316]Two primers were used to create the deletion:

Del-fadE-F(SEQ ID NO: 1)5′-AAAAACAGCAACAATGTGAGCTTTGTTGTAATTATATTGTAAACATATTGATTCCGGGGATCCGTCGACCDel-fadE-R(SEQ ID NO: 2)5′-AAACGGAGCCTTTCGGCTCCGTTATTCATTTACGCGGCTTCAACTTTCCTGTAGGCTGGAGCTGCTTC

[0317]The Del-fadE-F and Del-fadE-R primers were used to amplify the Kanamycin resistance (KmR) cassette from plasmid pKD13 (as described in Datsenko et al., supra) by PCR. The PCR product was then used to transform electrocompetent E. coli MG1655 cells containing pKD46 (described in Datsenko et al., supra). These cells had been previously induced with arabinose for 3-4 h. Follow...

example 2

[0319]This example describes the construction of a genetically engineered microorganism in which the expression of a fatty acid degradation enzyme and an outer membrane protein receptor are attenuated.

[0320]The fhuA (also known as tonA) gene of E. coli MG1655, which encodes a ferrichrome outer membrane transporter (GenBank Accession No. NP—414692), was deleted from strain E. coli MG1655 D1 of Example 1 using the Lambda Red system described in Datsenko et al., supra, but with the following modifications.

[0321]Two primers were used to create the deletion:

Del-fhuA-F(SEQ ID NO: 5)5′-ATCATTCTCGTTTACGTTATCATTCACTTTACATCAGAGATATACCAATGATTCCGGGGATCCGTCGACC;Del-fhuA-R(SEQ ID NO: 6)5′-GCACGGAAATCCGTGCCCCAAAAGAGAAATTAGAAACGGAAGGTTGCGGTTGTAGGCTGGAGCTGCTTC

[0322]The Del-fhuA-F and Del-fhuA-R primers were used to amplify the KmR cassette from plasmid pKD13 by PCR. The PCR product obtained was used to transform the electrocompetent E. coli MG1655 D1 cells containing pKD46 (see Example 1). These cel...

example 3

[0325]This example describes the construction of a genetically engineered microorganism in which nucleotide sequences encoding a thioesterase, an acyl-CoA synthase, and an ester synthase are integrated into the microorganism's chromosome.

[0326]The following nucleotide sequences, ′tesA, fadD, and aftA1, were integrated into the chromosome of E. coli MG1655 ΔfadE ΔfhuA strain (or DV2 strain, see Example 2) at the lacZ locus. The sequences were integrated in the order of ′tesA, followed by fadD, and followed by aftA1.

[0327]′tesA is a nucleotide sequence comprising a leaderless E. coli tesA (GenBank entry AAC73596, refseq accession U00096.2). ′tesA encodes an E. coli thioesterase (EC 3.1.1.5, 3.1.2.-) in which the first twenty-five amino acids were deleted and the amino acid in position 26, alanine, was replaced with methionine. That methionine then became the first amino acid of ′tesA. See Cho et al., J. Biol. Chem., 270:4216-4219 (1995).

[0328]E. coli fadD (GenBank entry AAC74875; REFS...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fermentation and recovery process for the production of biodiesel of commercial grade quality according to commercial and environmental standards (e.g., ASTM ANP, or EPA trace elements and emissions standards), by fermentation of carbohydrates using a genetically modified microorganism. The process provides a direct route for the production of fatty esters, without the need for producing oils which are later chemically transesterified with the concomitant production of large quantities of glycerin and other undesirable side-products.

Description

CROSS REFERENCE TO RELATED APPLICATIONS[0001]This application claims the benefit of U.S. Provisional Application Nos. 61 / 168,293, filed Apr. 10, 2009, 61 / 266,749, filed Jul. 20, 2009, 61 / 227,025, filed Jul. 20, 2009, and 61 / 262,544, filed Nov. 19, 2009, the entire content of each is hereby incorporated by reference.BACKGROUND OF THE INVENTION[0002]Petroleum is a limited, natural resource found in the Earth in liquid, gaseous, or solid forms. Petroleum is primarily composed of hydrocarbons, which are comprised mainly of carbon and hydrogen. It also contains significant amounts of other elements, such as, nitrogen, oxygen, or sulfur, in different forms.[0003]Petroleum is a valuable resource, but petroleum products are developed at considerable costs, both financial and environmental. First, sources of petroleum must be discovered. Petroleum exploration is an expensive and risky venture. The cost of exploring deep water wells can exceed $100 million. In addition to the economic cost, p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C10L1/19C12P7/649
CPCC10L1/026Y02E50/13C12P7/649Y02P30/20Y02E50/10C10L2200/0476C10L2270/026C10L2290/26
InventorSANCHEZ-RIERA, FERNANDOHUANG, WEISHASTRY, VINEET
OwnerGENOMATICA INC