Double knockout (gt/cmah-ko) pigs, organs and tissues

a technology of pigs and organs, applied in the field of xenotransplantation and genetic modification, can solve the problems of severe rejection of transplanted tissue, unmodified pig tissue into human (or other primate), and insufficient suitable organs for transplantation, so as to improve the symptoms of hyperacute rejection

Inactive Publication Date: 2014-04-24
INDIANA UNIV RES & TECH CORP
View PDF1 Cites 30 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The present patent provides a knockout pig with disrupted genes for α(1,3)-galactosyltransferase (αGal) and CMAH. This reduces the amount of these molecules in the pig compared to a wild-type pig, which helps decrease hyperacute rejection when transplanting pig tissue into a human. The knockout pig can also be used to produce glycoproteins with lower amounts of Neu5Gc or αGal epitopes compared to a wild-type pig. The disruptions in the genes are caused by a three base pair deletion adjacent to a G to A substitution for αGal and a four base pair insertion for CMAH. Overall, this invention provides a way to improve the safety and efficiency of pig-derived organs for transplantation.

Problems solved by technology

However, it is also well known that there are not enough suitable organs available for transplant to meet current or expected clinical demands for organ transplants.
However, xenotransplantation using standard, unmodified pig tissue into a human (or other primate) is accompanied by severe rejection of the transplanted tissue.
The hyperacute response to the pig antibodies present on the transplanted tissue is so strong that the transplant is typically damaged by the human immune system within minutes or hours of transplant into the human recipient.
The antibodies are present in the patient's blood prior to implantation of the tissue, resulting in the intense and immediate rejection of the implanted tissue.
Unfortunately, developing homozygous knockout pigs is a slow process, requiring as long as three years using homologous recombination in fetal fibroblasts followed by somatic cell nuclear transfer (SCNT), and then breeding of heterozygous knockout animals.
The development of new knockout pigs for xenotransplantation has been hampered by the lack of pluripotent stem cells, relying instead on the fetal fibroblast as the cell upon which genetic engineering was carried out.
Unfortunately, while the GTKO pig may have eliminated anti-αGal antibodies as a barrier to xenotransplantation, studies using GTKO cardiac and renal xenografts in baboons show that the GTKO organs still trigger an immunogenic response, resulting in rejection or damage to the transplanted organ.
Some negative control histograms are difficult to see because of significant overlap with the experimental group.
Negative controls are shown (*) but are difficult to see in some panels because of significant overlap with the experimental group.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double knockout (gt/cmah-ko) pigs, organs and tissues
  • Double knockout (gt/cmah-ko) pigs, organs and tissues
  • Double knockout (gt/cmah-ko) pigs, organs and tissues

Examples

Experimental program
Comparison scheme
Effect test

example 1

Design of Zinc Finger Nucleases (ZFN)

[0059]A pair of ZFN were designed to bind and cleave the sequence of porcine CMAH exon 9 (SEQ ID NO: 1-AAACTCCTGAACTACAAGGCTCGGCTGGTGAAGGA) beginning at position 1,341 of Ensemble transcript ENSSSCT00000001195. Another pair of ZFN were designed to bind and cleave the region of GGTA1 exon 8 (SEQ ID NO: 2-GTCATCTTTTACATCATGGTGGATGATATCTCCAGGATGCC) beginning at position 1165 of Ensemble transcript ENSSSCT00000006069. The ZFN activities were validated in yeast (Sigma-Aldrich, St. Louis, Mo.). Additional detail regarding the ZFN of the present invention can be found in Li et al., Journal of Surgical Research, (2012)E1-E7 Epub 2012 Jul. 3, which is incorporated by reference herein for all purposes.

example 2

Cell Culture and Transfection of Porcine Liver Derived Cells

[0060]Porcine adult liver derived cells (LDC) were isolated with modifications from the method described in Li et al, 2010 Cell Reprogram. 12:599. Isolated LDC were cultured in a combination stem cell media (SCM) (α-MEM:EGM-MV 3:1) (Invitrogen / Lonza, Switzerland) supplemented with 10% fetal bovine serum (FBS) (Hyclone, Logan, Utah), 10% horse serum (Invitrogen, Carlsbad, Calif.), 12 mM HEPES, and 1% Pen / Strep (Invitrogen) as described in Li et al 2012 JSR Epub 2012 Jul. 3. A commercial porcine strain (Landrace / York / Chester White) was used as the source of the LDC. Neon transfection system was used according to the manufacturer's instruction (Invitrogen).

[0061]Briefly, LDC were harvested by trypsin digestion, washed with calcium and magnesium free Dulbecco's phosphate buffered saline (DPBS) (Invitrogen) and centrifuged. 106 cells were suspended in 120 μl of resuspension buffer (Invitrogen) containing 2 μgs of each CMAH ZFN p...

example 3

Surveyor Mutation Detection Assay (CEL I Assay)

[0063]ZFN-induced mutation was detected using the Surveyor Mutation Detection kit (Transgenomic, Omaha, Nebr.). At day 5 post-transfection, genomic DNA from ZFN-treated and control plasmid pEGFP-N1 treated cells was extracted and PCR was performed using primers ZFN-CMAH-F (SEQ ID NO: 3-5′ GGACCTGCTTTATCTTGCTCGC 3′), ZFN-CMAH-R (SEQ ID NO: 4-5′ CCATACTTGTCTGCTGGGTGGG 3′). Pwo SuperYield DNA Polymerase, dNTPack (Roche, Indianapolis, Ind.) was used and the PCR conditions were as follows: 94° C., 2 minutes; 94° C., 15 seconds, 55° C., 30 seconds and 68° C., 50 seconds for 15 cycles; 94° C., 15 seconds, 5 5° C., 30 seconds and 68° C., 50 seconds with additional 5 seconds for each cycle, for 25 cycles and a final extension step of 68° C. for 5 minutes.

[0064]PCR product was denatured and annealed using the following program on a MyCycler (Bio-Rad): 95° C., 10 minutes; 95° C. to 85° C., −2° C. / second; 85° C. to 25° C., −0.1° C. / second. 200-400 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
pHaaaaaaaaaa
sizeaaaaaaaaaa
mean fluorescence intensitiesaaaaaaaaaa
Login to View More

Abstract

The invention provides double knockout transgenic pigs (GT / CMAH-KO pigs) lacking expression of any functional αGAL and CMAH. Double knockout GT / CMAH-KO transgenic organs, tissues and cells are also provided. Methods of making and using the GT / CMAH-KO pigs and tissue are also provided.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This application claims priority to, and the benefit of, U.S. Provisional Patent Application No: 61 / 717,845, filed Oct. 24, 2012, which is incorporated herein by reference in its entirety for all purposes.INCORPORATION OF SEQUENCE LISTING[0002]The sequence listing in text format submitted herewith is herein incorporated by reference in its entirety for all purposes.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT[0003]Not applicable.FIELD OF THE INVENTION[0004]The present invention is generally in the field of xenotransplantation and genetic modification to produce transgenic animals, organs tissue, or cells suitable for transplantation into a human.BACKGROUND[0005]It is well known that transplants from one animal into another animal of the same species, such as human to human, are a routine treatment option for many serious conditions, including kidney, heart, lung, liver and other organ disease. However, it is also well k...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N9/10C12N9/02C12N15/85A01K67/027A61K35/407
CPCC12N9/1048A01K67/0276C12N9/0071C12N15/8509A61K35/407C12N9/22C12N9/2465C12N15/8778A01K2217/00A01K2217/15A01K2227/108A01K2267/025C07K2319/80A01K2217/075C12N15/907
InventorTECTOR, A. JOSEPH
OwnerINDIANA UNIV RES & TECH CORP