Vaccine for preventing pneumococus infection

A Streptococcus pneumoniae and vaccine technology, applied in antibacterial drugs, immunoglobulins, bacterial antigen components, etc., can solve the problems of difficult treatment of pneumococcal disease and the need for enhanced vaccination

Inactive Publication Date: 2009-08-05
MUCOSIS
View PDF27 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These strains make treatment of pneumococcal disease difficult and these further reinforce the need for vaccination as an alternative means of preventing the high morbidity and mortality associated with pneumococcal infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vaccine for preventing pneumococus infection
  • Vaccine for preventing pneumococus infection
  • Vaccine for preventing pneumococus infection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0127] The relationship between the antibody titer against the surface protein of Streptococcus pneumoniae and the occurrence of the first acute otitis media

[0128] Survey of some groups in Finland

[0129] Such as Figure 1-5 IgG titers against PpmA, SlrA, and IgAl proteases were all lower than those against S. pneumoniae α-enolase in patients with a first onset of otitis media. Due to the lack of correlation between antibody titers and protection, SlrA and IgAl proteases were considered to have no added value for protective immunity and thus would not be selected as vaccine components.

Embodiment 2

[0131] Immunoprotective potential of surface proteins of Streptococcus pneumoniae

[0132] To determine the protective potential of S. pneumoniae surface proteins, both active and passive immunization / challenge experiments were performed.

[0133] method

[0134] mouse strain

[0135] Female mice of the MF1 cross were immunized and purchased from Harlan Olac, Bicester, UK. All mice were housed and free from specific pathogens. Active immunizations were initiated with 6-week-old mice (25-30 g) and passive immunizations with 9-week-old mice (30-35 g). strain

[0136] Streptococcus pneumoniae D39, serotype 2, was obtained from the National Center for Type Cultures (NCTC 7466; Central Public Health Laboratory, London). Streptococcus pneumoniae TIGR4, serotype 4, was obtained from the Genome Institute. Bacteria were grown on No. 2 blood agar matrix (Oxoid, Basingstoke, UK) supplemented with 5% (vol / vol) defibrinated horse blood (BAB). Stock cultures were prepared by inoculat...

Embodiment 3

[0255] Research on In silico

[0256] The nucleotide sequence of PpmA was determined by searching partial homology in the database.

[0257] The PpmA gene was amplified by PCR from Streptococcus pneumoniae D39 using the following primers:

[0258] 5' CCATGGCTAGCCACCATCACCATCACCATTCGAAAGGGTCAGAAGGTGC 3' and 5' TCATGGATCCGGACTATTCGTTTGATGTAC 3', which insert flanking NheI and BamHI restriction sites, and N-terminal His 6 mark. The amplified DNA was cloned into pETlla expression vector (Stratagene, LaJolla, CA) and electrotransfected into E. coli BL21(DE3). Ni was carried out by using HisTrap kit (Amersham Pharmacia) according to the manufacturer's suggestion. + Affinity chromatography was used to purify the recombinant protein.

[0259] Purified recombinant proteins were diafiltered with anti-10 mM HEPES buffer, pH 7.5, lyophilized and stored at -20°C.

[0260] PpmA

[0261] The ppmA Nucleotide Sequence of Streptococcus pneumoniae D39

[0262]ATGAAGAAAAAATTATTGGCAGGTGCCAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biology, more specifically to the field of immunology and microbiology. The invention further relates to the field of vaccines against microbial infections and especially bacterial vaccines, in particular to pneumococcal vaccines. More in particular, the invention relates to means and methods to identify, select and isolate a vaccine component for passive and / or active immunisation against a microorganism that can be killed by opsonophagocytic cells. <??>The invention relates to a method to identify an opsonophagocytosis inducing antigen as a vaccine component for immunisation against a microorganism. The invention describes three pneumococcal proteins SlrA, IgA1 proteinase, and PsaA, and their use as a vaccine component with or without PpmA. <??>The invention also discloses the use of antibodies against said proteins for passive immunisation.

Description

technical field [0001] The present invention relates to the field of biology, more particularly to the fields of immunology and microbiology. The invention further relates to the field of vaccines against microbial infections and in particular bacterial vaccines such as pneumococcal vaccines. More specifically, the present invention relates to ways and means of identifying, selecting and isolating vaccine components to produce vaccines for passive and / or active immunization against microorganisms that are recognized and preferably taken up and more preferably killed by opsonophagocytic cells method. Background technique [0002] Streptococcus pneumoniae is a pathogen that causes serious infections such as pneumonia, septicemia, meningitis, and otitis media, and is responsible for more than three million deaths each year, one million of them children. The problem of antimicrobial resistance in S. pneumoniae has been exacerbated by the successful spread of a limited number o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N33/48A61K39/02A61K39/09A61K39/395C07K16/12G01N33/569
CPCC07K16/1275G01N33/56911A61K39/092A61K2039/505A61P31/04A61P37/04Y02A50/30
Inventor科内利斯·约翰尼斯·利恩霍特斯罗纳德·德格罗特彼得·威廉默斯·玛丽亚·赫尔曼斯
OwnerMUCOSIS