Supercharge Your Innovation With Domain-Expert AI Agents!

Human papilloma virus 16 type DNA vaccine and gene adjuvant and its application

A DNA vaccine, gene technology, applied in recombinant DNA technology, DNA/RNA fragments, applications, etc., can solve problems such as uncomfortable vaccines, difficult immune protection reactions, etc.

Inactive Publication Date: 2007-10-31
THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the wild-type E7 gene has oncogenic activity and is difficult to induce an effective immune protective response in the body, it is not suitable for direct use in vaccine research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human papilloma virus 16 type DNA vaccine and gene adjuvant and its application
  • Human papilloma virus 16 type DNA vaccine and gene adjuvant and its application
  • Human papilloma virus 16 type DNA vaccine and gene adjuvant and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1. Transformation method of antigen gene mE7 gene:

[0026] Obtain the wild-type human papillomavirus type 16 E7 gene sequence (HPV16E7) known to those skilled in the art from the Gene Bank, and then based on the HPV16E7 gene, perform multiple transformations on it at the same time: first, perform multiple loci on the E7 gene site-directed mutation, introducing two point mutations C61G and C93G in the zinc finger binding region of the E7 gene; introducing three point mutations in the Rb binding region DLYCYEQ to mutate DLYCYEQ into DGYGYGQ, and then rearrange the E7 gene after "cutting" (Gene shuffling), choose two cutting points, one is located between the two serines (31S / 32S) at the recognition site of E7 protein kinase, and the other is located at position 60 in the first zinc finger binding region of E7 protein Between the 61st amino acid (60K / 61C), the E7 gene is "cut" into three segments, which are named a, b, and c in sequence, and then rearranged acc...

Embodiment 2

[0027] Embodiment 2. Construction method of recombinant mE7 expression plasmid

[0028] The HPV16E7 gene modified in Example 1 was named mE7 and has the sequence of SEQ ID NO.1, and the cloning plasmid Puc-mE7 containing the mE7 gene was obtained by gene synthesis. According to the strategy shown in Figure 1, the mE7 gene was recombined into the VR1012 eukaryotic expression plasmid: first, the upstream primer was designed according to the mE7 gene sequence: mE7-5': CGAGTCGTGCGGCCGCCACCATGGATCTGC and the downstream primer mE7-3': GCTCTAGAGCTTAGGTAGTCTCGGGCTGCAG. The 5' and 3' ends of the upstream and downstream primers were designed with NotI and XbaI restriction sites, respectively. The mE7 gene was amplified by PCR using the Puc-mE7 plasmid as a template. The reaction conditions were: pre-denaturation at 95°C for 300 s, and then 25 cycles of amplification reactions: denaturation at 94°C for 60 s, renaturation at 60°C for 60 s, extension at 72°C for 60 s, and finally Extend a...

Embodiment 3

[0029] Example 3. Construction method of recombinant mE7 / HSP70 fusion antigen gene expression plasmid

[0030] According to the strategy shown in Figure 2, the mE7 / HSP70 gene was recombined into the VR1012 eukaryotic expression plasmid: in order to obtain the fusion antigen gene mE7 / HSP70 of the mE7 gene and the mycobacterium tuberculosis heat shock protein gene HSP70, first construct the mE7 gene without the stop codon The specific steps are as follows: design the upstream primer according to the mE7 gene sequence: mE7-5': CGAGTCGTGCGGCCGCCACCATGGATCTGC and the downstream primer mE7-3'N: GCTCTAGAGCGGTAGTCTCGGGCTGCAG, the 5' end and the 3' end of the upstream and downstream primers are respectively designed with NotI and XbaI enzymes cut site. According to the method described in Example 2, the mE7 expression vector VR1012-mE7(N) without the stop codon was obtained, which was used to construct the mE7 / HSP70 fusion gene. Then, according to the Mycobacterium tuberculosis HSP70 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a human warts virus 16 type (HPV16)DNA vaccine antigen gene, fuse antigen gene, eucaryon expressing plasmid and construction eucaryon expressing plasmid of IL-15 ripe peptide cDNA with human IL-2 signal peptide on the vaccine adjuvant gene N end, which is characterized by the following: possessing stronger immunogen property; generating more CD8+T cells with E7 specificity; preventing formation of transferring tumor with avoidance immune; co-immunizing with IL-15 gene adjuvant; further-improving antineoplastic activity of the vaccine especially immunization therapy activity of tumor; removing tumor cell in mouse body completely with jointing IL-15 gene adjuvant. This DNA vaccine and gene adjuvant can be used to prevent and cure carcinomatous conversion and immunization therapy of carcinoma.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a DNA gene obtained by means of biotechnology, a vaccine containing the gene and its application. Background technique [0002] Chronic persistent human papillomavirus type 16 (HPV16) infection is the main cause of cervical cancer in women. In addition, HPV infection is also closely related to oral cancer, esophageal cancer, penile cancer, bladder cancer and other malignant tumors. Cervical cancer is the main cause of death for women due to malignant tumors. There are about 500,000 new cases of cervical cancer and 200,000 deaths every year worldwide, and 2 / 3 of the cases are in developing countries. my country is a high-incidence area of ​​cervical cancer. In some backward areas, the incidence rate of cervical cancer ranks first among the malignant tumors of women. About 139,000 patients die of cervical cancer in my country every year. At present, there is no good strategy for the t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/37C07K19/00C12N15/63C12N15/79C12N15/62A61K48/00A61K39/12A61P35/00
Inventor 许雪梅许于飞王庆勇宋国兴曾毅司静懿
Owner THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More