Human epiterm growth-factor receptor mutation gene and use thereof

A technology of epidermal growth factor and mutant gene, applied in genetic engineering, plant gene improvement, application, etc., can solve the problems of lack of prognosis evaluation mode for treatment methods, influence of drug efficacy, and non-utilization

Inactive Publication Date: 2007-11-14
GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the existing targeted therapy drugs target the EGFR signaling pathway, which is an effective anti-tumor target, they do not take advantage of the specificity of this EGFR mutation, so they have not formed in different human populations or even individuals. Individualized treatment affects the efficacy of drugs
[0007] In addition, the current targeted drug therapy for NSCLC patients usual

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human epiterm growth-factor receptor mutation gene and use thereof
  • Human epiterm growth-factor receptor mutation gene and use thereof
  • Human epiterm growth-factor receptor mutation gene and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1: Screening for gene mutations in the EGFR TK region

[0049] Screening samples mainly include: original tumor sample genomic DNA and cancer cell line cDNA.

[0050] Three pairs of primers targeting exon 19 to 21 of EGFR were designed to screen EGFR in genomic DNA. See Table 1 for details of the primers used to amplify the EGFR-TK region (tyrosine kinase region) in the cDNA of cancer cell lines.

[0051] Table 1 Primer amplification of EGFR TK exon

[0052]

Primer

Exon

Sequence (5'>3')

Ta(°C)

product length

(bp)

E19F1

E19R1

E20F1

E20R1

E21F1

E21R1

EGFRTKF 1

EGFRTKF 1

19

19

20

20

twenty one

twenty one

TK

TK

AGCCCCCAGCAATATCAGCCTTAGGTG

ATGGGAGAGGCCAGTGCTGTCTCTAAG

GCATTCATGCGTCTTCACCTGGAAGG

GCACACACATATCCCCATGGCAAACTC

CGCCAGCCATAAGTCCTCGACGTGGAG

TCTGGAGAGCATCCTCCCCTGCATGTG

GGAGAAGCTC...

Embodiment 2

[0057] Example 2: Comparison of EGFR TK mutation frequency in NSCLC in China and other regions abroad

[0058] Genomic tumor DNA samples from 41 Chinese NSCLC patients and DNA samples from 10 non-adenocarcinoma tissues were randomly selected. Of the 41 samples, 30 were males and 11 were females. Male patients ranged in age from 43 to 77 years (mean 57 years), while female patients ranged in age from 31 to 64 years (mean 48 years). Seventeen cases were lung adenocarcinoma, 21 cases were squamous cell carcinoma, and 3 cases were adenosquamous cell carcinoma. Twenty patients had a history of smoking, while 21 had no history of smoking.

[0059] 7 human cancer cell lines used for gene mutation screening, mainly including 2 cases of lung cancer cell line 95D, NCI-H460, 2 cases of prostate cancer cell line PC-3, Du-145, and Hela, HT-1080 and MCF- 7 and other cell lines.

[0060] Table 2 Comparison of the 3 EGFR TK mutation frequencies in Chinese NSCLC with those in other foreign...

Embodiment 3

[0062] Embodiment 3: Expression of EGFR TK region mutant gene (for example specific mutation site) in Escherichia coli

[0063] Design primers (see Table 3 for details), amplify the TK region mutant gene from the full-length gene of EGFR, clone it into the expression vector pET15b of Escherichia coli by restriction endonuclease, transform Escherichia coli DH5a to obtain the recombinant. Then, the obtained recombinant was transformed into Escherichia coli expression strain BL21 to obtain the expression strain rBL21-ETK of the mutant gene of the epidermal growth factor receptor EGFR TK region.

[0064] Table 3 EGFR TK region mutant gene amplification primers

[0065] Primer

[0066] Inoculate the strain rBL21-ETK, grow it to OD0.8, add IPTG at a final concentration of 1mM, induce expression for 4 hours, collect the bacteria by centrifugation, add lysis buffer to resuspend, and then perform ultrasonic lysis in an ice bath . After breaking the bacteria, the centrifuged p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

This invention relates to the medicine preparation and the gene diagnosis application, especially in non-small cell lung cancer drug targeted therapy Preparation and treatment of non-small cell lung cancer of human epidermal growth factor receptor gene detection applications. Provides many kinds of person epidermal cell growth factor acceptor (EGFR) mutant gene, preparation for Chinese non-small cell lung cancer (NSCLC) targeted therapy drug target genes, gene diagnosis using target, especially for non-small Human cell lung cancer treatment epidermal growth factor receptor gene detection of gene targets, making malignancies, particularly NSCLC gene targeting drugs and the development of diagnostic reagents have a clear role in site, thus enabling more specific targeted therapy , to carry out the individualized cancer treatment.

Description

technical field [0001] The present invention relates to a variety of human epidermal growth factor receptor (EGFR) mutant genes and their applications, and to the application of drug preparation and gene diagnosis, especially in the preparation of non-small cell lung cancer targeted therapy drugs and the treatment of non-small cell lung cancer. Application of growth factor receptor gene detection. Background technique [0002] Malignant tumors are a serious threat to human health, and their treatment has also become the focus of attention. Due to the lack of specificity, traditional chemotherapy and radiotherapy often bring great toxic and side effects to patients while achieving curative effect. For this reason, the research of anti-tumor targeted drugs has attracted people's attention day by day. [0003] As we all know, currently the commonly used therapeutic targets for targeted therapy of malignant tumors mainly include: cell receptors, signal transduction and anti-an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/12C12N1/21C07K1/14C12N15/86A61P35/00C12Q1/68
Inventor 裴端卿秦宝明陈晓
Owner GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap