Recombinant production of serum albumin
A technology for serum albumin and human serum albumin, applied in the field of recombinant serum albumin production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0275] Example 1. Cloning of the gene encoding human serum albumin (HSA)
[0276] HSA has various applications, for example as a culture medium component or for drug delivery. It would be interesting to determine whether HSA can be expressed at economically beneficial levels in currently used hosts, especially filamentous fungi.
[0277] Human adult male liver first-strand cDNA was ordered and received from Stratagene (Cat# 780621). The following two oligo DNAs were also ordered and received from:
[0278] 190203J1
[0279] SEQ ID NO: 9: ATGGACGGATCCACAATGAAGTGGGTAACCTTTATTTCC
[0280] 190203J2
[0281] SEQ ID NO: 10: ATGGACCCGCGGCTCGAGTTATAAGCCTAAGGCAGCTTGACTTGC
[0282] The following PCR was performed with Pwo polymerase (Roche) using both oligo DNA and cDNA as templates: 94°C 5min 25* (94°C 30sec, 55°C 30sec, 72°C 3min) 72°C 7min.
[0283] The resulting PCR fragment was cloned into blunt pCR4 using the TOPO kit recommended by the manufacturer (Invitrogen, Cat# 601059)...
Embodiment 2
[0287] Embodiment 2. HSA cDNA expression plasmid is transformed in the Aspergillus oryzae
[0288] Plasmid pENI3054 was transformed into Aspergillus oryzae strain JA1355 (WO2004 / 069872). The procedure was carried out according to the method mentioned in 2004 / 069872.
[0289] Ten transformants were grown in 200ul YPM in 96-well microtiter plates for 3 days at 34°C.
[0290] Detect 20 μl of the supernatant on SDS-PAGE to determine whether Aspergillus oryzae expresses HSA. No detectable bands.
Embodiment 3
[0291] Embodiment 3. HSA cDNA expression plasmid is transformed in the Aspergillus niger
[0292] Plasmid pENI3054 was transformed into Aspergillus niger strain MBin115 (prepared as described in Example 9 of WO2004 / 090155).
[0293] Ten transformants were grown in 200 μl YPM in 96-well microtiter plates for 3 days at 34°C.
[0294] Detect 20 μl of the supernatant on SDS-PAGE to determine whether Aspergillus niger expresses HSA. No detectable bands.
PUM
Property | Measurement | Unit |
---|---|---|
size | aaaaa | aaaaa |
size | aaaaa | aaaaa |
size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com