Check patentability & draft patents in minutes with Patsnap Eureka AI!

Recombinant production of serum albumin

A technology for serum albumin and human serum albumin, applied in the field of recombinant serum albumin production

Inactive Publication Date: 2008-02-20
NOVOZYMES AS
View PDF27 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Said primary particles cannot be easily dispersed in liquid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant production of serum albumin
  • Recombinant production of serum albumin
  • Recombinant production of serum albumin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0275] Example 1. Cloning of the gene encoding human serum albumin (HSA)

[0276] HSA has various applications, for example as a culture medium component or for drug delivery. It would be interesting to determine whether HSA can be expressed at economically beneficial levels in currently used hosts, especially filamentous fungi.

[0277] Human adult male liver first-strand cDNA was ordered and received from Stratagene (Cat# 780621). The following two oligo DNAs were also ordered and received from:

[0278] 190203J1

[0279] SEQ ID NO: 9: ATGGACGGATCCACAATGAAGTGGGTAACCTTTATTTCC

[0280] 190203J2

[0281] SEQ ID NO: 10: ATGGACCCGCGGCTCGAGTTATAAGCCTAAGGCAGCTTGACTTGC

[0282] The following PCR was performed with Pwo polymerase (Roche) using both oligo DNA and cDNA as templates: 94°C 5min 25* (94°C 30sec, 55°C 30sec, 72°C 3min) 72°C 7min.

[0283] The resulting PCR fragment was cloned into blunt pCR4 using the TOPO kit recommended by the manufacturer (Invitrogen, Cat# 601059)...

Embodiment 2

[0287] Embodiment 2. HSA cDNA expression plasmid is transformed in the Aspergillus oryzae

[0288] Plasmid pENI3054 was transformed into Aspergillus oryzae strain JA1355 (WO2004 / 069872). The procedure was carried out according to the method mentioned in 2004 / 069872.

[0289] Ten transformants were grown in 200ul YPM in 96-well microtiter plates for 3 days at 34°C.

[0290] Detect 20 μl of the supernatant on SDS-PAGE to determine whether Aspergillus oryzae expresses HSA. No detectable bands.

Embodiment 3

[0291] Embodiment 3. HSA cDNA expression plasmid is transformed in the Aspergillus niger

[0292] Plasmid pENI3054 was transformed into Aspergillus niger strain MBin115 (prepared as described in Example 9 of WO2004 / 090155).

[0293] Ten transformants were grown in 200 μl YPM in 96-well microtiter plates for 3 days at 34°C.

[0294] Detect 20 μl of the supernatant on SDS-PAGE to determine whether Aspergillus niger expresses HSA. No detectable bands.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
sizeaaaaaaaaaa
sizeaaaaaaaaaa
sizeaaaaaaaaaa
Login to View More

Abstract

The present invention relates to modified nucleotide sequences encoding serum albumin, wherein the mRNA sequence has been codon optimized for expression in a filamentous host cell. Furthermore the present invention relates to serum albumin produced in filamentous fungi or loaded by contacting serum albumin with an extract of a filamentous fungi culture. In an-other aspect the present invention relates to the use of said serum albumin in serum free cell culture media and also to a method of drying and agglomerating serum albumin thereby im-proving wettability and dispersability.

Description

field of invention [0001] The present invention relates to methods for the recombinant expression of serum albumin (albumin) in filamentous fungal host organisms, modified nucleic acid sequences encoding bovine and human serum albumin proteins (BSA and HSA, respectively), loaded serum albumin Protein product, use of loaded serum albumin, and process for preparing dry particles and dry particles comprising serum albumin. Background of the invention [0002] Serum albumin, especially bovine serum albumin (BSA) is one of the most widely used proteins in molecular biology and industry. [0003] Previously, serum albumin like BSA or HSA has been isolated by blood fractionation. This way of delivering serum albumin suffers greatly from the disadvantage of possible contamination with pathogens. In the case of bovine serum albumin, the infectious protein (prion) thought to cause mad cow disease (BSE) is a particular problem associated with the production of BSA by blood fractionat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/67C12P21/02C07K14/765A61K38/38C12R1/645C12R1/66C12R1/685C12R1/69
Inventor 毕贾克·克里斯坦森卡斯藤·约尔特托马斯·A·波尔森波尔·巴赫
Owner NOVOZYMES AS
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More