Primer, detection method and detection reagent kit for detecting type G2 norovirus
A detection kit, the technology of the kit, applied in the directions of biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the detection method and detection kit for norovirus GII type without detection problem, to achieve the effect of wide application, strong specificity and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Example A pair of amplification of known norovirus G II virus specimen capsid protein gene
[0054] 1) Design of primer set
[0055] The 5095---5319bp nucleic acid sequence of the Norovirus G II type-specific capsid protein gene was screened out by consulting the literature and using BLAST software analysis, targeting six sites of the fragment (these six sites were respectively: 5095-5112bp , 5113-5130bp, 5158-5178bp, 5207-5228bp, 5267-5286bp, 5300-5319bp) LAMP primers were designed and synthesized to obtain the following primers. Primer design was completed by LAMP-specific primer design software combined with molecular biology analysis software Advance Vector NTI.
[0056] serial number 1
[0057] Forward outer primer F3-G II CGTCGAATGACGCCAACC
[0058] serial number 2
[0059] Reverse outer primer B3-G II CGCTCCACAGTATCTCACCT
[0060] serial number 3
[0061] Forward internal primer FIP-G II CGGGCTCCAGAGCCATAACCTCATCTGATGGGTCCGCAG
[0062] serial number 4
[...
Embodiment 2
[0103] The difference between this embodiment and Embodiment 1 is that in this embodiment, in the gene amplification stage based on the LAMP method, in order to speed up the amplification reaction speed, the amplification reaction solution also includes:
[0104] serial number 5
[0105] Forward loop primer LF-G II TTATTGACCCTCTGGGACGAGG
[0106] serial number 6
[0107] Reverse Loop Primer LB-G II GAAACAATTTTGTACAAGCCCCCTG
[0108] at this time:
[0109] The forward loop primer LF-G II: amplifies the complementary sequence starting from 5135-5155bp (cctcgtcccagaggtcaataa);
[0110]The reverse loop primer LB-G II: amplification starts at 5242-5265bp
[0111] (gaaacaattttgtacaagcccctg)
[0112] Now the reaction system is: (total reaction volume is 25ul)
[0113]
[0114]
[0115] After adding the above-mentioned forward loop primer LF-G II and reverse loop primer LB-G II, it only needs to be kept in a constant temperature water bath at 65°C for about 60 minutes, and...
Embodiment 3
[0117] The difference between this example and Example 2 is that in this example, the reaction system used for gene amplification based on the LAMP method is:
[0118] The reaction system is: (the total reaction volume is 25ul)
[0119]
[0120] In addition to the nucleic acid template, the above reaction system can be simplified to amplification reaction solution, enzyme and double distilled water.
[0121] Amplification reaction solution: containing 10×BstDNA Polymerase Buffer reaction buffer, 2mM magnesium sulfate, 1.0uM forward inner primer FIP-G II, 1.0uM reverse inner primer BIP-G II, 0.15uM forward outer primer F3-G II, 0.15uM reverse outer primer B3-G II, 1.0mM dNTP, 0.6uM forward loop primer LF-G II, 0.6uM reverse loop primer LB-G II and 0.8M betaine (betaine); wherein 10 ×Bst DNA Polymerase Buffer reaction buffer contains 200mM trishydroxymethionine methane-hydrochloride (Tris-Hcl) at pH 8.8, 100mM potassium chloride, 100mM ammonium sulfate, 20mM magnesium sulfat...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
