Primer, detection method and detection reagent kit for detecting type G2 norovirus

A detection kit, the technology of the kit, applied in the directions of biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the detection method and detection kit for norovirus GII type without detection problem, to achieve the effect of wide application, strong specificity and high sensitivity

Inactive Publication Date: 2010-12-15
ZHUHAI DISEASE PREVENTION & CONTROL CENT
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is currently no detection method and detection kit for the detection of Norovirus GII by the loop-mediated isothermal amplification method.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, detection method and detection reagent kit for detecting type G2 norovirus
  • Primer, detection method and detection reagent kit for detecting type G2 norovirus
  • Primer, detection method and detection reagent kit for detecting type G2 norovirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example A pair of amplification of known norovirus G II virus specimen capsid protein gene

[0054] 1) Design of primer set

[0055] The 5095---5319bp nucleic acid sequence of the Norovirus G II type-specific capsid protein gene was screened out by consulting the literature and using BLAST software analysis, targeting six sites of the fragment (these six sites were respectively: 5095-5112bp , 5113-5130bp, 5158-5178bp, 5207-5228bp, 5267-5286bp, 5300-5319bp) LAMP primers were designed and synthesized to obtain the following primers. Primer design was completed by LAMP-specific primer design software combined with molecular biology analysis software Advance Vector NTI.

[0056] serial number 1

[0057] Forward outer primer F3-G II CGTCGAATGACGCCAACC

[0058] serial number 2

[0059] Reverse outer primer B3-G II CGCTCCACAGTATCTCACCT

[0060] serial number 3

[0061] Forward internal primer FIP-G II CGGGCTCCAGAGCCATAACCTCATCTGATGGGTCCGCAG

[0062] serial number 4

[...

Embodiment 2

[0103] The difference between this embodiment and Embodiment 1 is that in this embodiment, in the gene amplification stage based on the LAMP method, in order to speed up the amplification reaction speed, the amplification reaction solution also includes:

[0104] serial number 5

[0105] Forward loop primer LF-G II TTATTGACCCTCTGGGACGAGG

[0106] serial number 6

[0107] Reverse Loop Primer LB-G II GAAACAATTTTGTACAAGCCCCCTG

[0108] at this time:

[0109] The forward loop primer LF-G II: amplifies the complementary sequence starting from 5135-5155bp (cctcgtcccagaggtcaataa);

[0110]The reverse loop primer LB-G II: amplification starts at 5242-5265bp

[0111] (gaaacaattttgtacaagcccctg)

[0112] Now the reaction system is: (total reaction volume is 25ul)

[0113]

[0114]

[0115] After adding the above-mentioned forward loop primer LF-G II and reverse loop primer LB-G II, it only needs to be kept in a constant temperature water bath at 65°C for about 60 minutes, and...

Embodiment 3

[0117] The difference between this example and Example 2 is that in this example, the reaction system used for gene amplification based on the LAMP method is:

[0118] The reaction system is: (the total reaction volume is 25ul)

[0119]

[0120] In addition to the nucleic acid template, the above reaction system can be simplified to amplification reaction solution, enzyme and double distilled water.

[0121] Amplification reaction solution: containing 10×BstDNA Polymerase Buffer reaction buffer, 2mM magnesium sulfate, 1.0uM forward inner primer FIP-G II, 1.0uM reverse inner primer BIP-G II, 0.15uM forward outer primer F3-G II, 0.15uM reverse outer primer B3-G II, 1.0mM dNTP, 0.6uM forward loop primer LF-G II, 0.6uM reverse loop primer LB-G II and 0.8M betaine (betaine); wherein 10 ×Bst DNA Polymerase Buffer reaction buffer contains 200mM trishydroxymethionine methane-hydrochloride (Tris-Hcl) at pH 8.8, 100mM potassium chloride, 100mM ammonium sulfate, 20mM magnesium sulfat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to a fast analytical technique on foodborn pathogens based on loop-mediated isothermal amplification (LAMP), and provides primers which are used for analysis on GII of noro-virus, and capable of amplifying the specific base sequence of the target gene, which encodes a capsid protein (accession number of GenBank: X86557) of GII of noro-virus, and the primer is complemented with a partial sequence on the sites from 5095 to 5319 of the target gene, or with the complementary chain of the partial sequence. The present invention provides a group of primers with specificity on the specific gene segments of GII of norovirus, with the utilization of the kit comprising the group of primers, to analyze whether a specific gene segment of GII of noro-virus exists in the sample under analysis, thereby identifying whether GII of norovirus exists in the sample.

Description

technical field [0001] The invention relates to a rapid detection technology for food-borne pathogens based on a loop-mediated isothermal amplification (loop-mediated isothermal amplification, LAMP) technology. In particular, it relates to a primer and a primer set specific to a specific gene fragment of Norovirus G II type; it also relates to a detection method and a detection method for detecting Norovirus G II type of Norovirus G II type by using a loop-mediated isothermal amplification method to detect the primer and the primer set Reagent test kit. Background technique [0002] High incidence of foodborne diseases caused by Salmonella, Shigella, Staphylococcus aureus, Proteus, Vibrio cholerae, Vibrio parahaemolyticus and E.coli O157:H7, rotavirus and norovirus G The incidence of food poisoning caused by type II accounts for a very high proportion of the incidence of foodborne diseases in my country, and it is a serious public health problem. [0003] At present, the de...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11C12Q1/70
Inventor 魏泉德张彩虹谭爱军张丽荣
Owner ZHUHAI DISEASE PREVENTION & CONTROL CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap