Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation for N-acetylneuraminic acid by immobilization double-enzyme method

A technology of acetylneuraminic acid and neuraminic acid aldolase, which is applied in the field of preparing N-acetylneuraminic acid, and can solve the problems of long reaction time and the inability to reuse enzymes, etc.

Inactive Publication Date: 2008-04-23
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI +1
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But in the production that two enzymes co-transform N-acetylglucosamine and pyruvate to generate N-acetylneuraminic acid, the enzymes used are free enzymes, and its disadvantage is that the enzymes cannot be reused, and the reaction time is longer (about 240 Hour)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation for N-acetylneuraminic acid by immobilization double-enzyme method
  • Preparation for N-acetylneuraminic acid by immobilization double-enzyme method
  • Preparation for N-acetylneuraminic acid by immobilization double-enzyme method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0108] Acquisition of N-acetylglucosamine-2-epimerase (E.C.5.1.3.8) gene from porcine kidney and construction of recombinant plasmid pRYepi

[0109] with the following primers

[0110] 1: 5'catatggagaaggagcgcgaa 3' (Seq.ID.No.1)

[0111] 2: 5'gaattctaggcgaggcggctcagca 3' (Seq.ID.No.2)

[0112] As primers, pig kidney total RNA was used as a template for reverse transcription PCR amplification, and after PCR, the reference molecular clone was subjected to 0.9% agarose gel electrophoresis. After electrophoresis, the 1.2Kb size fragment was recovered using the gel recovery kit.

[0113] The obtained DNA fragment was subcloned into the pKS vector, digested with Nde I and EcoR I, recovered after gel electrophoresis, and the vector pET28(b) was ligated with the former by T4 ligase overnight at 16°C after the same treatment. The overnight ligated DNA was transformed into E.coli DH5α competent cells. Recombinants were selected on LB plates containing kanamycin. The recombinant DNA...

Embodiment 2

[0115] Acquisition of N-acetylneuraminic acid aldolase (E.C.4.1.3.3) gene from total DNA of E.coli TG1 and construction of recombinant plasmid pNA1

[0116] with the following primers

[0117] 1: 5'gacgctaccatggcaacgaatttacgt 3' (Seq.ID.No.3)

[0118] 2: 5'gatccagtcgactcgcccgcgctcttg 3' (Seq.ID.No.4)

[0119] As a primer, the total DNA of E.coli TG1 was used as a template for PCR amplification. After PCR, the recovered 0.9kb fragment was digested with Nco I and HindIII, cloned into pUC118 plasmid, named pNA, and transformed into E.coli TG1. coli DH5α competent cells.

[0120] After that, the following primers

[0121] 1: 5'ggaattccatatggcaacgaatttacgtggcg 3' (Seq.ID.No.5)

[0122] 2: 5'cgggatcctcacccgcgctcttgcatc 3' (Seq.ID.No.6)

[0123] As a primer, use the plasmid pNA as a template to carry out PCR amplification. After the PCR, the recovered 0.9kb fragment is digested with Nde I and BamH I, cloned into the pET28b vector plasmid, and transformed into E.coli DH5α compete...

Embodiment 3

[0125] Fermentation of engineering bacteria BL21(DE3) / pRYepi and preparation of immobilized N-acetylglucosamine-2-epimerase

[0126] Use 3L TB culture medium (to prepare broth for every increase in concentration, add in 900ml deionized water: 12g of peptone for bacterial culture; 24g of yeast extract for bacterial culture; 4ml of glycerol. Autoclave for 20 minutes, then cool the solution to 60 ℃ or below 60 ℃, then add 100ml and sterilize to get 0.17mol / LKH 2 PO 4 , 0.72mol / L K 2 HPO 4 Solution) ferment the engineered bacteria BL21(DE3) / pRYepi in a 5L fermenter, culture it at 37°C for about 1 hour, add lactose with a final concentration of 1% to induce, and lower the temperature to 22°C at the same time, add a final concentration of 0.5 % lactose induction, ferment for about 26 hours, close the tank, centrifuge at 8000rpm for 10 minutes to collect the bacteria.

[0127] Weigh 30g of the BL21(DE3) / pRYepi fermented for 26 hours, add 45ml of 0.5M pH7.5 sodium phosphate buffer...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a process of producing N-acetylneuraminic acid with two kinds of immobilized enzyme. In the process, immobilized N-acetylglucosamine-2-epimerase (E.C.5.1.3.8) in the concentration of 0.6-10 U / ml and immobilized N-acetylneuraminate aldolase (E.C.4.1.3.3) in the concentration of1.2-10 U / ml are utilized in the identical reactor to convert N-acetylglucosamine and pyruvic acid or its salt into N-acetylneuraminic acid. The process can reach N-acetylglucosamine converting rate up to 77 %, and has a conversion reaction period within 20 hr, repeated use of enzyme source and great industrial significance.

Description

technical field [0001] The invention relates to a method for preparing N-acetylneuraminic acid by enzymatic reaction, in particular to a method for preparing N-acetylneuraminic acid by using immobilized enzyme. Background technique [0002] In the biological pathway of neuraminic acid metabolism in organisms, N-acetylglucosamine isomerized to produce N-acetylmannosamine, which is catalyzed by the reaction of N-acetylmannosamine and pyruvate through N-acetylneuraminic acid aldolase Neuraminic acid can be produced. Neuraminic acid and its derivatives are bound to the surface of organisms through transglycosylation reactions to exert their biological effects. Sialic acid (N-acetylneuraminic acid and its derivatives) plays a very important role in the process of cell signal transduction and mutual recognition. For example, in the process of influenza virus infection of host cells, the sialidase of influenza virus can Recognizes N-acetylneuraminic acid and its derivatives, and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P19/26
Inventor 杨蕴刘陈军白骅饶娆胡世元邵丽君罗家立杨仲毅姜卫红杨晟
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com