Preparation for N-acetylneuraminic acid by immobilization double-enzyme method
A technology of acetylneuraminic acid and neuraminic acid aldolase, which is applied in the field of preparing N-acetylneuraminic acid, and can solve the problems of long reaction time and the inability to reuse enzymes, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0108] Acquisition of N-acetylglucosamine-2-epimerase (E.C.5.1.3.8) gene from porcine kidney and construction of recombinant plasmid pRYepi
[0109] with the following primers
[0110] 1: 5'catatggagaaggagcgcgaa 3' (Seq.ID.No.1)
[0111] 2: 5'gaattctaggcgaggcggctcagca 3' (Seq.ID.No.2)
[0112] As primers, pig kidney total RNA was used as a template for reverse transcription PCR amplification, and after PCR, the reference molecular clone was subjected to 0.9% agarose gel electrophoresis. After electrophoresis, the 1.2Kb size fragment was recovered using the gel recovery kit.
[0113] The obtained DNA fragment was subcloned into the pKS vector, digested with Nde I and EcoR I, recovered after gel electrophoresis, and the vector pET28(b) was ligated with the former by T4 ligase overnight at 16°C after the same treatment. The overnight ligated DNA was transformed into E.coli DH5α competent cells. Recombinants were selected on LB plates containing kanamycin. The recombinant DNA...
Embodiment 2
[0115] Acquisition of N-acetylneuraminic acid aldolase (E.C.4.1.3.3) gene from total DNA of E.coli TG1 and construction of recombinant plasmid pNA1
[0116] with the following primers
[0117] 1: 5'gacgctaccatggcaacgaatttacgt 3' (Seq.ID.No.3)
[0118] 2: 5'gatccagtcgactcgcccgcgctcttg 3' (Seq.ID.No.4)
[0119] As a primer, the total DNA of E.coli TG1 was used as a template for PCR amplification. After PCR, the recovered 0.9kb fragment was digested with Nco I and HindIII, cloned into pUC118 plasmid, named pNA, and transformed into E.coli TG1. coli DH5α competent cells.
[0120] After that, the following primers
[0121] 1: 5'ggaattccatatggcaacgaatttacgtggcg 3' (Seq.ID.No.5)
[0122] 2: 5'cgggatcctcacccgcgctcttgcatc 3' (Seq.ID.No.6)
[0123] As a primer, use the plasmid pNA as a template to carry out PCR amplification. After the PCR, the recovered 0.9kb fragment is digested with Nde I and BamH I, cloned into the pET28b vector plasmid, and transformed into E.coli DH5α compete...
Embodiment 3
[0125] Fermentation of engineering bacteria BL21(DE3) / pRYepi and preparation of immobilized N-acetylglucosamine-2-epimerase
[0126] Use 3L TB culture medium (to prepare broth for every increase in concentration, add in 900ml deionized water: 12g of peptone for bacterial culture; 24g of yeast extract for bacterial culture; 4ml of glycerol. Autoclave for 20 minutes, then cool the solution to 60 ℃ or below 60 ℃, then add 100ml and sterilize to get 0.17mol / LKH 2 PO 4 , 0.72mol / L K 2 HPO 4 Solution) ferment the engineered bacteria BL21(DE3) / pRYepi in a 5L fermenter, culture it at 37°C for about 1 hour, add lactose with a final concentration of 1% to induce, and lower the temperature to 22°C at the same time, add a final concentration of 0.5 % lactose induction, ferment for about 26 hours, close the tank, centrifuge at 8000rpm for 10 minutes to collect the bacteria.
[0127] Weigh 30g of the BL21(DE3) / pRYepi fermented for 26 hours, add 45ml of 0.5M pH7.5 sodium phosphate buffer...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com