Gene for regulating sensibility of plants to auxin and uses thereof
A technique of auxin, sensitivity, applied in the field of plant genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment approach
[0073] As an embodiment of the present invention, the gene encoding the PLDzeta2 protein is cloned into an appropriate vector (such as the binary vector p35S-1301) by conventional methods, and the recombinant vector with the foreign gene is introduced into the In plant cells, tissues or organs expressing the PLDzeta2 protein, and then obtain plants overexpressing the PLDzeta2 gene.
[0074] Preferably, the method for preparing the high plant of auxin sensitivity comprises: (1) the coding gene of exogenous PLDzeta2 albumen is transferred into plant cell, tissue or organ, obtains the plant cell, the tissue that is transformed into the coding gene of PLDzeta2 albumen , organs; and (2) regenerating the plant cells, tissues and organs obtained in step (1) into plant plants.
[0075] As a preferred example, the method comprises the steps of:
[0076] (s1) providing an Agrobacterium carrying an expression vector containing a gene encoding the PLDzeta2 protein;
[0077] (s2) contact...
Embodiment 1
[0100] The cloning of embodiment 1PLDzeta2 gene
[0101] A full-length cDNA clone of the PLDzeta2 gene was obtained by conventional 96-well PCR method for screening phage libraries (Alfandari, D., and Darribère, T. (1994). Asimple PCR method for screening cDNA libraries. PCR Methods Appl. 4, 46-49). In the following examples or drawings, the PLDzeta2 gene obtained from Arabidopsis thaliana is also referred to as AtPLDzeta2 or AtPLDζ2.
[0102] First, primers were designed at the 3' end of the gene according to the known genome sequence information (i.e. the gene sequence of At3g55940 in GenBank):
[0103] AtPLDζ2-1: 5'-TGATCGTTATTTCCGCTAC-3' (SEQ ID NO: 3);
[0104] AtPLDζ2-2: 5'-AAGGTTCCCTCTTGTCTC-3' (SEQ ID NO: 4).
[0105] The primers were used to screen the Arabidopsis thaliana hypocotyl phage cDNA library (purchased from the Arabidopsis thaliana Biological Research Center, ABRC, or refer to http: / / www.arabidopsis.org / ), and the cDNA containing the full-length sequence of ...
Embodiment 2
[0108] Isolation and identification of T-DNA insertion mutant atpldζ2 of embodiment 2PLDζ2
[0109] In order to study the physiological function of the AtPLDζ2 gene, the present inventors also searched the Arabidopsis T-DNA insertion mutant library of the Salk Institute (http: / / signal.salk.edu / tabout.html). The search results show that the mutant line numbered Salk_119084 is an insertion mutant of AtPLDζ2, and the insertion site is 14bp from the end of the third intron in its corresponding AtPLDζ2 gene (Locusnumber is At3g55940) to the fourth exon Location.
[0110] The mutants obtained from the Salk mutant library were screened for Kan resistance, and then the T-DNA insertion site was detected for the resistant plants. Using conventional methods to extract DNA from the seedlings of the plant, using primer Lba1 (5'TGGTTCACGTAGTGGGCCATCG3 (SEQ ID NO: 5)') and gene-specific primer P2 (5'-CTCTAGCAAATGAGAGTCTAG-3' (SEQ ID NO: 6)) on the T-DNA vector PCR amplification was perform...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More