Unlock instant, AI-driven research and patent intelligence for your innovation.

Increase of plants drought resistance by using mouse nitrous oxide synthetase gene

A technology of nitric oxide and synthase, applied in the field of crop genetics and breeding, to achieve the effect of small environmental impact

Inactive Publication Date: 2008-09-10
SHANGHAI ACAD OF AGRI SCI
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] So far, the research results of NO are mostly obtained through in vitro experiments such as exogenous NO or external NO donors, and previous research reports often have some contradictory results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Increase of plants drought resistance by using mouse nitrous oxide synthetase gene
  • Increase of plants drought resistance by using mouse nitrous oxide synthetase gene
  • Increase of plants drought resistance by using mouse nitrous oxide synthetase gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Gene modification of inducible nitric oxide synthase in mice

[0029] Firstly, the mouse nitric oxide synthase gene was obtained. Take about 100 grams of mice, kill them, freeze them quickly in liquid nitrogen, and store them in a -70°C refrigerator for extraction of total RNA. The cDNA synthesis kit was produced by Clontech; the DNA column recovery kit was purchased from Amersham; the reagent RNA extraction kit RNeasy Plant MiniKit was produced by QIAGEN; various restriction enzymes and T4DNA Ligase were purchased from Shanghai Takara Company. Total RNA was extracted using RNeasy Plant Mini Kit from QIAGEN.

[0030] The synthesis of mouse cDNA was performed according to the instructions of Clontech's SMART cDNA Library Construction Kit for first-strand synthesis. Using the first strand of the synthesized cDNA as a template, using muiNOSZ: 5'AAGGATCCATGGCTTGCCCCTGGAAGTTTCTCTTC and muiNOSF: AAGAGTCTCAGAGCCTCGTGGCTTTG GGCTCCTC as primers, the cDNA was amplified by PCR. ...

Embodiment 2

[0041] Construction of Plant Expression Vector of Mouse Inducible Nitric Oxide Synthase

[0042] The above cloned plasmid containing the modified mouse inducible nitric oxide synthase gene fragment was double digested with BamHI and SacI respectively, the DNA fragment was recovered, and the mouse inducible nitric oxide synthase gene was synthesized by T4 DNA ligase It was ligated with the pYPX245 plasmid containing double 35S promoters (National Center for Biotechnology Information, USA), double-digested with BamHI and SacI, and the fragment length was 3435bp. The sequence was determined by DNA sequencer, and the recombinant plasmid pYPXmuiNOS containing mouse inducible nitric oxide synthase gene was obtained. As shown in Figure 2. The expression vector also contains a GUS reporter gene and a kanamycin resistance marker gene with an intron (Chinese patent ZL 00 1 19754.8).

Embodiment 3

[0044] Agrobacterium cultivation and plant transformation

[0045] Agrobacterium strains are Agrobacterium tumefaciens EHA105, LBA4404, GV3101, AGL-1 strains. The plasmid was introduced into Agrobacterium (purchased from American Type Culture Collection) by electroporation. Pick a single bacterium and culture it overnight in 25ml of YEB medium containing 50mg / l rifampicin, transfer 5ml of the bacterial liquid to 100ml of YEB medium containing 50mg / l rifampicin, and cultivate until OD600=0.7-0.8, the bacteria Place on liquid ice for 10 minutes, centrifuge at 5000rpm for 10min, 4°C, collect the bacteria, add 100ml sterile double distilled water to wash twice. Add 4ml of 10% glycerol to suspend the bacteria and transfer to a 50ml centrifuge tube. Centrifuge at 5500rpm for 10min at 4°C. Collect the bacteria, add 500 μl of 10% glycerol to suspend the bacteria, and transfer to a 1.5ml centrifuge tube. Take 70 μl of competent cells and add 1 μl of recombinant plasmid pYPXmuiNOS. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a mouse inducible nitric oxide synthase gene which is transformed into a plant to improve the capability of drought resistance of the plant. The invention respectively uses two restriction endonucleases which are BamHI and SacI to digest the mouse inducible nitric oxide synthase gene with site-directed mutagenesis, has the digested mouse inducible nitric oxide synthase gene (muiNOS) connected with a pYPX 245 (AY178049) plant expression vector containing a double 35S promoter through T4DNA joinase, and acquires a recombinant plasmid pYPXmuiNOS containing the target gene muiNOS by digestion identification and sequence analysis. Finally, the mouse inducible nitric oxide synthase gene is transformed into the plant to acquire a transgenic plant with the capability of drought resistance.

Description

technical field [0001] The invention belongs to the field of crop genetics and breeding. Specifically, the mouse nitric oxide synthase gene is transformed into plants by using Agrobacterium, so that it can be efficiently expressed in plants, and the drought resistance ability of plants is improved. Background technique [0002] Drought is one of the main environmental factors that affect plant growth and development. Drought can affect the water status of plants and cause plants to suffer from water shortage. According to statistics, the world's arid and semi-arid areas account for 34.9% of the land area. The impact of drought on world crop production ranks first among many natural adversities, and its damage is equivalent to the sum of other disasters. my country's arid and semi-arid areas account for about 52% of the country's land area, and the annual water shortage in irrigated areas across the country is about 30 billion cubic meters. 35 to 40 billion kilograms of grai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/52C12N15/10C12N15/82A01H1/00A01H5/00
Inventor 彭日荷姚泉洪熊爱生薛永高峰付晓燕李贤田永生赵伟
Owner SHANGHAI ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More