Increase of plants drought resistance by using mouse nitrous oxide synthetase gene
A technology of nitric oxide and synthase, applied in the field of crop genetics and breeding, to achieve the effect of small environmental impact
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Gene modification of inducible nitric oxide synthase in mice
[0029] Firstly, the mouse nitric oxide synthase gene was obtained. Take about 100 grams of mice, kill them, freeze them quickly in liquid nitrogen, and store them in a -70°C refrigerator for extraction of total RNA. The cDNA synthesis kit was produced by Clontech; the DNA column recovery kit was purchased from Amersham; the reagent RNA extraction kit RNeasy Plant MiniKit was produced by QIAGEN; various restriction enzymes and T4DNA Ligase were purchased from Shanghai Takara Company. Total RNA was extracted using RNeasy Plant Mini Kit from QIAGEN.
[0030] The synthesis of mouse cDNA was performed according to the instructions of Clontech's SMART cDNA Library Construction Kit for first-strand synthesis. Using the first strand of the synthesized cDNA as a template, using muiNOSZ: 5'AAGGATCCATGGCTTGCCCCTGGAAGTTTCTCTTC and muiNOSF: AAGAGTCTCAGAGCCTCGTGGCTTTG GGCTCCTC as primers, the cDNA was amplified by PCR. ...
Embodiment 2
[0041] Construction of Plant Expression Vector of Mouse Inducible Nitric Oxide Synthase
[0042] The above cloned plasmid containing the modified mouse inducible nitric oxide synthase gene fragment was double digested with BamHI and SacI respectively, the DNA fragment was recovered, and the mouse inducible nitric oxide synthase gene was synthesized by T4 DNA ligase It was ligated with the pYPX245 plasmid containing double 35S promoters (National Center for Biotechnology Information, USA), double-digested with BamHI and SacI, and the fragment length was 3435bp. The sequence was determined by DNA sequencer, and the recombinant plasmid pYPXmuiNOS containing mouse inducible nitric oxide synthase gene was obtained. As shown in Figure 2. The expression vector also contains a GUS reporter gene and a kanamycin resistance marker gene with an intron (Chinese patent ZL 00 1 19754.8).
Embodiment 3
[0044] Agrobacterium cultivation and plant transformation
[0045] Agrobacterium strains are Agrobacterium tumefaciens EHA105, LBA4404, GV3101, AGL-1 strains. The plasmid was introduced into Agrobacterium (purchased from American Type Culture Collection) by electroporation. Pick a single bacterium and culture it overnight in 25ml of YEB medium containing 50mg / l rifampicin, transfer 5ml of the bacterial liquid to 100ml of YEB medium containing 50mg / l rifampicin, and cultivate until OD600=0.7-0.8, the bacteria Place on liquid ice for 10 minutes, centrifuge at 5000rpm for 10min, 4°C, collect the bacteria, add 100ml sterile double distilled water to wash twice. Add 4ml of 10% glycerol to suspend the bacteria and transfer to a 50ml centrifuge tube. Centrifuge at 5500rpm for 10min at 4°C. Collect the bacteria, add 500 μl of 10% glycerol to suspend the bacteria, and transfer to a 1.5ml centrifuge tube. Take 70 μl of competent cells and add 1 μl of recombinant plasmid pYPXmuiNOS. ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 