Method for amidating polypeptides with basic aminoacid C- terminals by means of specific endoproteases

A technology of amino acid and trypsin, applied in the preparation method of peptides, chemical instruments and methods, specific peptides, etc., can solve the problems of failure and low yield, achieve huge cost advantages, and avoid the effect of yield loss

Inactive Publication Date: 2008-09-17
SANOFI AVENTIS DEUT GMBH
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It was therefore concluded that a trypsin-catalyzed semi-synthetic approach, which afforded the preparation of peptides of C-terminally-linked polylysinamide or polyarginine or poly-lysine / arginine mixed sequences, was unsuccessful or only successfully obtained low yields

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] Example 1: Synthesis of Escherichia coli-specific DNA sequence encoding AVE (1-43)

[0074] First prepare the gene sequence SEQ ID No.6 encoding the peptide AVE(1-43) (SEQ ID No.7): SEQ ID No.6:

[0075] TTTTTTAAGCTTGCACGGTGAAGGTACCTTTCACCTCCGACCTGTC

[0076] CAAACAGATGGAAGAAGAAGCTGTTCGTCTGTTCATCGAATGGC

[0077] TGAAAAACGGTGGTCCGTCCTCCGGTGCTCCGCCTTCGAAAAAG

[0078] AAGAAAAAGTGATAATAGCATGCACGTGCGGCCGCACCTGGTCG

[0079] ACGAATTCAAAAAAAA

[0080] SEQ ID No. 7:

[0081] HGEGTFTSDL SKQMEEEAVR LFIEWLKNGG PSSGAPPSKK KKK

[0082] The gene sequence was synthesized by PCR technique. For this purpose, the following 5 primers were prepared by DNA chemical synthesis. Using the Rapid DNA Synthesis System (the Expedite TM DNA synthesis system) (from Applied Biosystems) for this synthesis.

[0083] a) Primer zp5u has the sequence of SEQ ID No.8:

[0084] 5′-TTTTTTAAGCTTGCACGGTGAAG-3′

[0085] SEQ ID No. 8 comprises regions 1-23 of the sense strand ("sense"). The triplet CA...

Embodiment 2

[0102] Embodiment 2: construct the expression vector of AVE (1-43)

[0103] US 5496924, the content of which is expressly incorporated in this application by reference, proposes an expression system by which atomically tailored fusion proteins can be produced. An advantage of this system is the ability to prepare fusion proteins with a small ballast portion. The expression system was used as in the examples in the application. The sequence A-B segment is fused with AVE(1-43) through the enterokinase recognition sequence DDDDK to produce a fusion protein with the following gene sequence and amino acid sequence (SEQ ID No.13 and No.14):

[0104] SEQ ID No. 13:

[0105] 5’-GGAAACAGAATTCATGGCGCCGACCTCTTCTTCTACCAAAAAG

[0106] CTCAACTGCAACTGGAACACCTGCTGCTGGACCTGCAGATGATC

[0107] CTGAACGGTATCAACAACTACAAAAACCCGAAACTGACGCGTAT

[0108] CGACGATGACGATAAACACGGTGAAGGTACCTTCACCTCCGACC

[0109] TGTCCAAACAGATGGAAGAAGAAGCTGTTCGTCTGTTCATCGAA

[0110] TGGCTGAAAAACGGTGGTCCGTCCTCCGGTGCTCCG...

Embodiment 3

[0131] Embodiment 3: construct the expression vector of AVE (1-39)

[0132] Plasmid pBZP43 was used as template for PCR reactions with primers pB primer f1 (Example 2) and psw3_ave_39rev. The PCR product was reacted with restriction enzymes EcoRI and NotI and inserted into EcoRI / NotI opened plasmid pBZP43 in a T4 ligase reaction following the instructions provided by the enzyme manufacturer. This product, the pBZP39 plasmid, was used to continue the procedure described in Example 2.

[0133] psw3_ave_39rev (SEQ ID No. 19):

[0134] 5′-TTTTTTGCGGCCGCACGTGCATGCTATTATCATTTCGAAGGCGGAGCACC-3′

[0135] The triplet TTT encodes a lysine at position 39.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for producing C-terminal amidated dibasic or polybasic peptides, consisting in reacting two peptides in the presence of trypsin biologically active enzymes and, if necessary, in purifying the thus obtainable compounds of formula (I) by means of protein chemistry.

Description

technical field [0001] The present invention relates to a method for the preparation of C-terminally amidated di-orpolybasic peptides, in particular those having human glucagon-like peptide-1 (GLP-1) biological Active peptides, or analogs or derivatives thereof. Background technique [0002] The stability, biomedical availability and duration of action of pharmaceutically relevant peptides and proteins largely depend on the nature of their molecular N-terminal or C-terminal. The half-life of biomolecules is significantly affected by C-terminal extensions with basic amino acids. In particular, good pharmaceutical activity can be obtained if, on C-terminal extensions with more than one basic amino acid, the amino acid ending at the C-terminus is an aminoamide. [0003] Such peptide-based active substances, if the peptide is small enough, can be directly prepared entirely by chemical synthesis according to the modified Merrifield synthesis scheme. However, limitations of thi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/575C07K14/605C12P21/02C12P21/06
CPCC07K14/57563A61K38/16C07K1/00C12P21/02C07K14/605A61K38/00A61P3/08Y02A50/30C07K14/575C12P21/06
InventorS·里佐姆P·哈伯曼C·萨拉尼亚德F·措赫尔L·兰德里克-布尔泰因
OwnerSANOFI AVENTIS DEUT GMBH