Construction of human insulinogen C peptide high-yield strains

A technology of human insulin and high-efficiency cells, which is applied in the direction of fungi, microorganism-based methods, biochemical equipment and methods, etc., can solve the problems of increasing separation and purification steps, reducing the yield of human proinsulin C-peptide, and achieving low cost Effect

Active Publication Date: 2009-03-11
TIBET JINKE GRP +2
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The advantage of this method is that a high-expression engineering strain of a fusion protein of poly(individual) human proinsulin C-peptide series can be obtained in Escherichia coli or yeast, and the disadvantage is that expensive dual proteases (trypsin and carboxypeptidase B) are required for cleavage , while increasing the separation and purification steps and being affected by the efficiency of double protease digestion, ultimately reducing the yield of human proinsulin C-peptide

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction of human insulinogen C peptide high-yield strains
  • Construction of human insulinogen C peptide high-yield strains
  • Construction of human insulinogen C peptide high-yield strains

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0038] Example 1 The construction process of the recombinant expression vector containing human proinsulin C peptide

[0039] Chemical synthesis of human proinsulin C-peptide gene: According to the amino acid sequence of human proinsulin C-peptide (SEQ ID NO: 2), two complementary nucleotide sequences were synthesized.

[0040] The forward nucleotide sequence contains the following sequence (5'→3'): gaggccgaagatta cag gtaggacaagttgagttgggaggaggcccaggggcaggctcgctacagcccttggccttggaaggctcactgcag;

[0041]The reverse nucleotide sequence contains the following sequence (5'→3'):

[0042] ctgcagtgagccttccaaggccaagggctgtagcgagcctgcccctggggcctcctcccaactcaacttgtcctacctgtaaatcttcggcctc.

[0043] Restriction endonuclease EcoR I was designed at the 5' end of the forward and reverse nucleotide sequences.

[0044] The human proinsulin C-peptide gene is obtained by annealing the two complementary nucleotide sequences. The above-mentioned nucleic acid product and expression vector pPIC3K we...

example 2

[0047] Example 2 Shake flask expression of human proinsulin C-peptide situation

[0048] Pick a single colony from the solid plate, inoculate into a 250mL shake flask containing 25mL BMGY, grow overnight at 30°C, 220rpm to OD 600 =4.

[0049] Inoculate the above 25mL culture solution into 1LBMGY, and continue to amplify to the cell concentration OD 600 =6.

[0050] Centrifuge at 5000rpm for 5min at room temperature to harvest the cells. Suspend the bacteria with fresh sterile BMMY to the OD of the bacteria solution 600 =1.0, 30°C, 220rpm induced expression of human proinsulin C-peptide. Samples were taken every 24 hours and supplemented with 100% methanol to a final concentration of 1.5%. After 120 hours of induction culture, the cells were harvested by centrifugation. The bacteria were analyzed by protein electrophoresis, and the results were as follows: figure 2 As shown, the results show that: human proinsulin C-peptide was expressed in Pichia pastoris.

[0051] Sh...

example 3

[0052] Example 3 Fermentative expression of human proinsulin C-peptide

[0053] Pick a single colony from the solid plate, inoculate into a 250mL shake flask containing 25mL BMGY, grow overnight at 30°C, 220rpm to OD 600 =4.

[0054] Inoculate the above 25mL culture solution into 250mL BMGY, and continue to amplify to the cell concentration OD 600 =6, inoculate the culture solution into 2L BSM fermentation medium, adjust pH=4.0-7.5, temperature at 28°C, DO=40%, rotating speed 500rpm, after cultivating for a period of time, DO rises rapidly to more than 100%, indicating After the consumption of glycerol in the medium was completed, 50% glycerol was added slowly, the glycerol flow rate was 30mL / h, and the DO was maintained above 35%, and the glycerol supplementation time was 4h.

[0055] Methanol induction stage: After stopping glycerol supplementation, DO rises rapidly to above 100%. After starvation for a period of time, methanol is slowly supplemented. The methanol flow rat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for expressing human proinsulin C peptide by yeast pichia. The method comprises the following steps: firstly, human proinsulin C peptide genes are synthesized; secondly, the genes are recombined with yeast pichia expression vectors, and the recombinant expression vectors obtained are transferred into the yeast pichia; and thirdly, an engineering strain for expressing the human proinsulin C peptide in high-efficiency cells is obtained through screening of a large number of transformants.

Description

technical field [0001] The invention belongs to the production method of recombinant polypeptide medicine in the field of medicine. Background technique [0002] Human proinsulin C-peptide is the connecting peptide between chain A and chain B in human proinsulin, containing 31 amino acids. Human proinsulin is enzymatically hydrolyzed to form equimolar insulin and C-peptide. Insulin is used to control blood sugar in diabetic patients. C-peptide was once considered to have no clinical value. The latest research proves that C-peptide can reduce the most serious complications of diabetic patients, such as diabetic nephropathy, diabetic retinopathy and diabetic neuropathy. The combination of insulin and C-peptide can effectively control blood sugar and reduce the occurrence of diabetic complications. Since human proinsulin C-peptide has great therapeutic value and economic value, countries are now vigorously developing its production technology and preclinical research, and it h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/17C12N15/81C12N1/19C12P21/04C12R1/84
Inventor王福清郑权王秀云
OwnerTIBET JINKE GRP