Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular identification method for siniperca chuatsi and siniperca scherzeri and kit

A technology of molecular identification and cocked mandarin fish, which is applied in the direction of biochemical equipment and methods, microbe determination/inspection, etc., to achieve the effect of promoting healthy development, wide applicability, and simple and quick operation

Inactive Publication Date: 2009-03-11
CHANGSHA UNIVERSITY
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It has the characteristics of separation according to the Mendelian method, rich polymorphic information content, and co-dominant inheritance. It is widely used in simple and rapid species identification. At present, there is no microsatellite molecular identification method for the identification of squid and spotted mandarin fish. related reports

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular identification method for siniperca chuatsi and siniperca scherzeri and kit
  • Molecular identification method for siniperca chuatsi and siniperca scherzeri and kit
  • Molecular identification method for siniperca chuatsi and siniperca scherzeri and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] 1. Extraction of DNA:

[0026] Genomic DNA was extracted by the phenol-chloroform method. 0.8% agarose gel electrophoresis and nucleic acid protein analyzer (Eppendorf products) to detect DNA concentration and purity.

[0027] 2. Amplify DNA fragments:

[0028] That is, the polymerase chain reaction, the DNA sequence of a pair of primers for the polymerase chain reaction is:

[0029] 1) Forward primer: 5'TACCCGCTCCAAATCTCT 3'

[0030] Reverse primer: 5′GTCTAATACAATACTCCCTCCTC 3′

[0031] 2) The PCR reaction system is as follows:

[0032]

[0033] After mixing, centrifuge at high speed for a few seconds.

[0034] 3) PCR reaction conditions: The PCR reaction was carried out on a PCR instrument, and the reaction program was: 94°C pre-denaturation for 5 minutes, and then 35 cycles according to the following conditions: 94°C denaturation for 30 seconds, 52°C annealing for 45 seconds, 72°C extension for 1 minute, cycle After the end of the reaction, extend at 72°C fo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for molecular identification of Siniperca chuatsi basilewsky and Siniperca scherzeri Steindachner and a kit used by the same. The method for molecular identification comprises the following steps: DNA extraction, DNA fragment amplification, electrophoresis of PCR products and identification by a silver-staining method. The kit contains a pair of SSR primers and a standard map. The method for molecular identification can improve the efficiency and accuracy of identification of Siniperca chuatsi basilewsky and Siniperca scherzeri Steindachner, and is expected to solve the identification problem in the aquiculture of Siniperca chuatsi basilewsky and Siniperca scherzeri Steindachner and stimulate the sound development of Siniperca chuatsi culture industry.

Description

technical field [0001] The invention belongs to the technical field of fish species identification in aquaculture, and in particular relates to a molecular identification method for mandarin fish and spotted mandarin fish and a kit used in the method. Background technique [0002] Mandarin fish (Siniperca chuatsi), commonly known as sweet-scented osmanthus fish, belongs to Perciformes (Perciformes) and Sinipercinae (Sinipercinae). It is a precious freshwater fish native to major rivers and lakes in China. There are three species of Siniperca kneri and Siniperca scherzeri. In the stage of fish species and adult fish, it can be identified by morphological methods, but it cannot be identified by morphological methods in the nursery stage. [0003] Microsatellites (Microsatellites) are a class of simple repetitive DNA sequences with high variability widely present in eukaryotic genomes. It has the characteristics of separation according to the Mendelian method, rich polymorphi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 刘臻鲁双庆张建社梅秋兰
Owner CHANGSHA UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com