Construction of interleukin 1beta specific mouse optical imaging system and use thereof
A technology of interleukins and uses, applied in the biological field, can solve the problems of not being able to truly reflect the inflammatory process in the body, restricting the development of anti-inflammatory drugs, and high research costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0085] Example 1 Construction of a vector containing an IL-1β-driven luciferase reporter gene
[0086] Design the following primers:
[0087] IL-1β upstream primer (SEQ ID NO: 2):
[0088] 5'AAATGAGTGACTTCCCCATGACGGC 3';
[0089] IL-1β downstream primer (SEQ ID NO: 3):
[0090] 5' CCCTGGATAAGTGGTACCAGAGCCC 3';
[0091] The upstream regulatory region (SEQ ID NO: 8), and then inserted into the upstream of the luciferase reporter gene (luciferase) of the vector pGL3-Basic (Promega) that had undergone the same restriction digestion by Kpn I and Bgl II double digestion, to obtain a human IL-1β upstream Regulatory region controlled reporter gene vector pGL3-IL-1β.
[0092] Design the following primers:
[0093] cHS4 upstream primer (SEQ ID NO: 4):
[0094] 5'GCTGGTACCTCACTGACTCCGTCCT 3';
[0095] cHS4 downstream primer (SEQ ID NO: 5):
[0096] 5'ATCGGGCCCGGAGCTCACGGGGACAGC 3';
[0097] The insulator cHS4 gene was amplified from the chicken genome by conventional PCR techno...
Embodiment 2
[0098] Example 2 Obtaining transgenic mice containing IL-1β-driven luciferase reporter gene
[0099] 2.1 Linearization vector
[0100] The vector was digested with Not I and Sal to obtain the linearized pIL1β-Luc-SV40 late poly(A), and the target fragment was recovered by tapping rubber.
[0101] 2.2 Microinjection of transgenic plasmids
[0102] The transgenic positive mice (hIL1β-Luc transgenic mice) containing the above-mentioned vectors were obtained by microinjection technique, and the specific methods for the preparation of transgenic mice were as follows:
[0103] 1. Select 7-8 week-old female mice with closed vaginal openings as donors, and inject pregnant horse serum PMSG (10 U) intraperitoneally into each mouse at around 3:00 pm.
[0104] 2. After 47-48 hours, inject human chorionic (hair) gonadotropin HCG (0.8 U) intraperitoneally into each mouse, and cage with normal male mice; take a few female mice of appropriate age (over 2 months old) As the recipient, the v...
Embodiment 3
[0130] Example 3 Research on lipopolysaccharide shock
[0131] Adult female hIL1β-Luc mice were injected intraperitoneally with LPS (3 mg / kg), and then, the expression of luciferase at different times in the mice was displayed using an in vivo imaging system.
[0132] see results Figure 6 , the results showed that under the stimulation of LPS, the expression of luciferase in mice was rapid within 1 hour, reached the peak at 3 hours, and then began to decline slowly.
[0133] In addition, by a method similar to Examples 1 and 2, the inventors prepared a luciferase reporter gene vector driven by positions 1-4460 in the sequence of SEQ ID NO: 8 and transformed it into mice. As a result, the mice The expression of luciferase at different times in the body is the same as that of the transgenic mice prepared in Examples 1 and 2.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap