Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction of interleukin 1beta specific mouse optical imaging system and use thereof

A technology of interleukins and uses, applied in the biological field, can solve the problems of not being able to truly reflect the inflammatory process in the body, restricting the development of anti-inflammatory drugs, and high research costs

Active Publication Date: 2009-07-01
SHANGHAI BIOMODEL ORGANISM SCI & TECH DEV +1
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the existing inflammation research models often cannot truly reflect the inflammatory process in the body because they are not in vivo models, or the animal models need to be slaughtered at different time points for research, which is complicated to operate and high in research costs, which limits the development of anti-inflammatory drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction of interleukin 1beta specific mouse optical imaging system and use thereof
  • Construction of interleukin 1beta specific mouse optical imaging system and use thereof
  • Construction of interleukin 1beta specific mouse optical imaging system and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] Example 1 Construction of a vector containing an IL-1β-driven luciferase reporter gene

[0086] Design the following primers:

[0087] IL-1β upstream primer (SEQ ID NO: 2):

[0088] 5'AAATGAGTGACTTCCCCATGACGGC 3';

[0089] IL-1β downstream primer (SEQ ID NO: 3):

[0090] 5' CCCTGGATAAGTGGTACCAGAGCCC 3';

[0091] The upstream regulatory region (SEQ ID NO: 8), and then inserted into the upstream of the luciferase reporter gene (luciferase) of the vector pGL3-Basic (Promega) that had undergone the same restriction digestion by Kpn I and Bgl II double digestion, to obtain a human IL-1β upstream Regulatory region controlled reporter gene vector pGL3-IL-1β.

[0092] Design the following primers:

[0093] cHS4 upstream primer (SEQ ID NO: 4):

[0094] 5'GCTGGTACCTCACTGACTCCGTCCT 3';

[0095] cHS4 downstream primer (SEQ ID NO: 5):

[0096] 5'ATCGGGCCCGGAGCTCACGGGGACAGC 3';

[0097] The insulator cHS4 gene was amplified from the chicken genome by conventional PCR techno...

Embodiment 2

[0098] Example 2 Obtaining transgenic mice containing IL-1β-driven luciferase reporter gene

[0099] 2.1 Linearization vector

[0100] The vector was digested with Not I and Sal to obtain the linearized pIL1β-Luc-SV40 late poly(A), and the target fragment was recovered by tapping rubber.

[0101] 2.2 Microinjection of transgenic plasmids

[0102] The transgenic positive mice (hIL1β-Luc transgenic mice) containing the above-mentioned vectors were obtained by microinjection technique, and the specific methods for the preparation of transgenic mice were as follows:

[0103] 1. Select 7-8 week-old female mice with closed vaginal openings as donors, and inject pregnant horse serum PMSG (10 U) intraperitoneally into each mouse at around 3:00 pm.

[0104] 2. After 47-48 hours, inject human chorionic (hair) gonadotropin HCG (0.8 U) intraperitoneally into each mouse, and cage with normal male mice; take a few female mice of appropriate age (over 2 months old) As the recipient, the v...

Embodiment 3

[0130] Example 3 Research on lipopolysaccharide shock

[0131] Adult female hIL1β-Luc mice were injected intraperitoneally with LPS (3 mg / kg), and then, the expression of luciferase at different times in the mice was displayed using an in vivo imaging system.

[0132] see results Figure 6 , the results showed that under the stimulation of LPS, the expression of luciferase in mice was rapid within 1 hour, reached the peak at 3 hours, and then began to decline slowly.

[0133] In addition, by a method similar to Examples 1 and 2, the inventors prepared a luciferase reporter gene vector driven by positions 1-4460 in the sequence of SEQ ID NO: 8 and transformed it into mice. As a result, the mice The expression of luciferase at different times in the body is the same as that of the transgenic mice prepared in Examples 1 and 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology, and discloses the establishment of an optical imaging system for an interleukin 1beta specific molecular mouse and application of the optical imaging system. The invention also discloses application of a transgenic animal, which is used for screening a substance with anti-inflammation effect. A 5' upstream regulatory region containing an interleukin 1beta gene is taken as a promoter to drive a reporter gene to serve as a vector to transfer into an animal genome through transgenic technology to obtain the transgenic animal; and the animal can quickly and sensitively be detected the change of the reporter gene in the body in an in vivo imaging system, the expression condition of interleukin 1beta is reflected in the body in a real-time and effective mode. The animal transferred with the gene can be taken as a model and used for screening the substance with the anti-inflammation effect; and a screening method has the advantages of simple operation, intuitivity and high sensitivity, has small damage to the animal, and can observe the dynamic reaction process of the reporter gene driven by an interleukin 1beta promoter in the body ofthe animal under the action of related substances in a real-time and continuous mode.

Description

technical field [0001] The invention belongs to the field of biotechnology, and more specifically, the invention relates to the use of a transgenic non-human mammal and a method for screening anti-inflammatory substances using the animal. Background technique [0002] Inflammation refers to a defense response of tissues or organs to harmful stimuli or damage. The inflammatory response mechanism of the body can resist the invasion of microorganisms and promote the repair of tissue damage, but too severe inflammatory response can cause tissue necrosis, cause dysfunction, and even quickly endanger the life of the patient, such as SARS, acute severe Hepatitis, etc.; and long-term inappropriate inflammatory response is an important pathological mechanism of many chronic diseases, such as liver cirrhosis, chronic nephritis, rheumatoid arthritis, etc. Recent studies have also shown that the occurrence and development of many tumors are also closely related to long-term inflammator...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11C12N15/85C12N5/10A01K67/027
Inventor 费俭李利妹王铸钢
Owner SHANGHAI BIOMODEL ORGANISM SCI & TECH DEV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com