Novel Bt protein Cry4Cc1, coding gene thereof and use
A bt protein and gene technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1 Cloning of cry4Cc1 gene
[0026] The present invention is a new bacterial strain of Bacillus thuringiensis (Bacillus thuringiensis) isolated from the soil in the virgin forest area of Muchuan, Sichuan Province. No. 3, Datun Road, Chaoyang District, City, Institute of Microbiology, Chinese Academy of Sciences, Zip Code 100101) is preserved, and the classification is named Bacillus thuringiensis (Bacillus thuringiensis), and the preservation number is CGMCC No.2719.
[0027] In this example, the full-length sequence of the cry4Cc1 gene was cloned by the following method.
[0028] The total DNA of strain BtMC28 was extracted using a genomic DNA purification kit (purchased from Saibaisheng Company). The primer sequences were designed as follows:
[0029] P1: 5'ATGAATTCATATCAAAATAAAAAATG3'
[0030] P2: 5'TTACCCTTTCATACAAAAGAAACTCG3
[0031] PCR reaction system:
[0032]10×buffer 2.5μl
[0033] MgCl 2 (25mM) 1.5μl
[0034] Taq enzyme 0.2μl
[0035] dNTPs ...
Embodiment 2
[0040] Example 2 Expression of cry4Cc1 gene and determination of insecticidal activity
[0041] According to the sequence at both ends of the open reading frame of the cry4Cc1 gene, a pair of specific primers cry4F: 5′-GCG were designed and synthesized CATATG (NdeI)ATGAATTCATATCAAAATAAAAATG-3'; cry4R: 5'-CG GAATTC (EcoR I) GCTCAAAGAAACATACTTTCCCATT-3', respectively at the 5' end primer Nde I and EcoR I restriction sites. The total DNA of BtMC28 was used as a template to amplify. The reaction procedure and amplification conditions were the same as in Example 1. The amplified product was double-digested with Nde I and EcoR I, and the digested product was the same as the carrier pET- 30a (+) connection, transformed E.coli DH5α competent cells, extracted its plasmid after digestion and electrophoresis to verify that the size of the inserted fragment met the expected purpose ( figure 2 ), and then transferred into the recipient strain E.coli.BL21(DE3). The recombinant plasmid...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com