Novel Bt protein Cry30Fa1, coding gene thereof and use
A technology of cry30fa1, bt protein, applied in application, genetic engineering, plant genetic improvement and other directions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1 Cloning of cry30Fa1 gene
[0026] The present invention is a new bacterial strain of Bacillus thuringiensis (Bacillus thuringiensis) isolated from the soil in the virgin forest area of Muchuan, Sichuan Province. No. 3, Datun Road, Chaoyang District, City, Institute of Microbiology, Chinese Academy of Sciences, Zip Code 100101) is preserved, and the classification is named Bacillus thuringiensis (Bacillus thuringiensis), and the preservation number is CGMCC No.2719.
[0027] In this example, the full-length sequence of the cry30Fal gene was cloned by the following method.
[0028] The total DNA of strain BtMC28 was extracted using a genomic DNA purification kit (purchased from Saibaisheng Company). The primer sequences were designed as follows:
[0029] P1: 5'ATGAAGCCGTATCAAAGTG3'
[0030] P2: 5'GTTCACTGGACAAGCAAATGC3'
[0031] PCR reaction system:
[0032] 10×buffer 2.5μl
[0033] MgCl 2 (25mM) 1.5μl
[0034] Taq enzyme 0.2μl
[0035] dNTPs (2.5mM) 2μ...
Embodiment 2
[0040] Example 2 Expression of cry30Fal gene and determination of insecticidal activity
[0041] According to the sequences at both ends of the open reading frame of the cry30Fa1 gene, a pair of specific primers cry30F: 5′-GCG were designed and synthesized CATATG (NdeI)ATGAAGCCGTATCAAAGTG-3'; cry30R: 5'-CG GAATTC (EcoR I)GTTCACTGGACAAGCAAATGC-3', respectively at the 5' end primer Nde I and EcoR I restriction sites. The total DNA of BtMC28 was used as a template to amplify. The reaction procedure and reaction system were the same as in Example 1. The amplified product was double digested with Nde I and EcoR I, and the digested product was the same as the vector pET-30a after double digestion. (+) ligation, transform E.coli DH5α competent cells, extract its plasmids, and electrophoresis to verify that the size of the inserted fragment meets the expected purpose ( figure 2 ), and then transferred into the recipient strain E.coli.BL21(DE3). The recombinant plasmid was named ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap