Recombination NuBCP-9 and Tumstatin(74-98) antitumor fusion polypetide

A fusion peptide, anti-tumor technology, applied in the direction of anti-tumor drugs, hybrid peptides, drug combinations, etc., can solve problems such as complex mechanisms and enhanced anti-tumor effects

Inactive Publication Date: 2009-09-09
CHINA PHARM UNIV
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The anti-tumor mechanism of bioactive peptides includes inhibiting tumor DNA synthesis, preventing tumor angiogenesis and metastasis, and inducing tumor cell apoptosis, etc., but the specific mechanism is more complicated, and different active peptides have different effects on different tumors. Combined application may enhance the anti-tumor effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombination NuBCP-9 and Tumstatin(74-98) antitumor fusion polypetide
  • Recombination NuBCP-9 and Tumstatin(74-98) antitumor fusion polypetide
  • Recombination NuBCP-9 and Tumstatin(74-98) antitumor fusion polypetide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1. Fusion peptide sequence design and spatial structure prediction

[0027] According to the amino acid sequence of NuBCP-9 and Tumstatin (74-98), a flexible peptide (G 4 S) 3 The nucleic acid sequence was designed according to the preferred codons of Escherichia coli, and adjusted appropriately according to the principles of PCR primer design ( figure 1 ). In order to determine whether the spatial structure after connection will affect the function of the respective peptides, we used the molecular simulation software MOE (molecular operating environment) to perform homology modeling predictions on the fusion peptide, using the protein with PDB number 1F3R.B as a template . The environment used in the space simulation is the physiological pH value water phase, and other settings are default. Forecast results such as figure 2 , it can be seen from the figure that its spatial structure can be well maintained and meets the design requirements.

Embodiment 2

[0028] Example 2. Construction of high-efficiency expression vectors

[0029] (1) Based on the amino acid sequences of NuBCP-9 and Tumstatin (74-98), the nucleic acid sequences were designed in comparison with the preferred codons of Escherichia coli, and were appropriately adjusted according to the principles of PCR primer design, and four primers were designed, respectively:

[0030] P1f::GAC GAATTC TTTAGCCGTAGCCTGCATAGCCTGCTGGGCGGTGGTGG

[0031] P2f: CCTGCTGGGCGGTGGTGGCAGCGGTGGCGGTGGCTCTGGTGGCGGTGGCAGCACCATGC

[0032] P3r: GCAAAATTGCACACATCATTCACATTGCAAAACAGAAACGGCATGGTGCTGCCACCGCC

[0033] P4r: CGC AAGCTT TTACAGCCAATAGCTATAATCATTACGGCTCGCAAAATTGCACACATCAT

[0034] At the same time, the restriction enzyme sites EcoR I and HindIII, and the protease Factor Xa site sequence were introduced.

[0035] (2) The NuBCP-9 / Tumstatin (74-98) fusion peptide gene was amplified by two-step SOE method.

[0036] The first step of PCR: using P2f and P3r as templates, adding Taq enzym...

Embodiment 3

[0040] Example 3. Expression and purification of fusion peptide NuBCP-9 / Tumstatin (74-98)

[0041] (1) Transform the positive cloned plasmid with correct sequencing into Escherichia coli expression strain BL21(DE3), insert the obtained transformants into LB liquid medium, culture at 37°C overnight, dilute 1:50 the next day and expand culture at 37°C for 3 hours , adding 0.5mM IPTG to induce expression at 30°C (attached Figure 6) , the expression form was analyzed by 12% SDS-PAGE, and the expression amount was analyzed by electronic scanning.

[0042] (2) The fusion protein TrxA-NuBCP-9 / Tumstatin (74-98) was expressed in a soluble form. After a large amount of expression, the bacteria were collected by centrifugation and resuspended with NTA-Resin Buffer. Collect the supernatant.

[0043] (3) Purification to obtain fusion protein

[0044] The supernatant was separated and purified by affinity chromatography column NTA Resin to obtain the fusion protein TrxA-NuBCP-9 / Tumstati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to NuBCP-9 and Tumstatin(74-98) fusion genetic engineering antitumor peptide which is designed to be synthetic primer according to colon bacillus favorable codon, NuBCP-9 and Tumstation(74-98) fusion peptide gene order connected by flexible peptide (G4S3) is obtained by PCR through an SOE method, the NuBCP-9 and Tumstation(74-98) fusion peptide forms recombination expression plasmid after connecting with a carrier Pet 32A(+), the recombination expression plasmid is transferred to colon bacillus BL21 for performing the soluble efficient expression and purifying and enzyme-cutting to obtain the purpose peptide. The fusion peptide has better inhibition function to skin cell proliferation in umbilical vein and lung cancer cell, primarily shows the multitarget antitumor effect, and can have better clinical application prospect.

Description

Technical field: [0001] The NuBCP-9 / Tumstatin (74-98) fusion genetic engineering anti-tumor peptide of the invention belongs to the technical field of genetic engineering production of vaccine medicine in the biopharmaceutical industry. It specifically involves the design of NuBCP-9 and Tumstatin (74-98) fusion peptide, the construction of expression vector, transformation, expression, purification and functional verification. Background technique: [0002] Tumor systems biology believes that tumor is a process involving multi-gene cooperation and multi-signaling pathways. Single molecular targeted therapy gradually shows its disadvantages. Therefore, combining drugs with different mechanisms of action for multi-target anti-tumor therapy can play a better role . Although the existing anti-tumor drugs have certain curative effects on most tumors, there are still problems such as low therapeutic efficiency, poor selectivity, high toxicity and side effects, and easy generation...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/17A61P35/00C12N15/12C07K19/00
Inventor奚涛杨家森邹佳宁那广水邢莹莹
OwnerCHINA PHARM UNIV