Unlock instant, AI-driven research and patent intelligence for your innovation.

Eriocheir sinensis Crustin-2 gene and application of recombinant protein thereof

A Chinese mitten crab, gene technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve various problems such as serious diseases and loss of breeding industry

Inactive Publication Date: 2009-10-28
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, with the continuous expansion of the scale of Chinese mitten crab farming, various diseases are becoming more and more serious, causing huge losses to the farming industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0011] The cDNA sequence cloning and in vitro recombinant expression of Chinese mitten crab Crustin-2 in the present invention comprise the following steps:

[0012] a) Extraction of total RNA of Eriocheir sinensis and purification of mRNA;

[0013] b) Construction of cDNA library of Chinese mitten crab;

[0014] c) Large-scale determination of the EST sequence of the Chinese mitten crab cDNA library;

[0015] d) Homology analysis of EST sequence of Chinese mitten crab and screening of Crustin-2 gene fragment;

[0016] e) EST sequence splicing to obtain the full sequence of Crustin-2;

[0017] f) In vitro recombinant expression and activity analysis of Chinese mitten crab Crustin-2.

[0018] The specific operation is as follows:

[0019] 1. Extraction of total RNA of Chinese mitten crab and purification of mRNA: Total RNA was extracted from hemolymph of Chinese mitten crab infected with Vibrio anguillarum using Trizol reagent from Invitrogen Company, and mRNA was purified ...

Embodiment 2

[0058] According to the cDNA sequence corresponding to SEQ ID NO.2, specific primers F2 (CATATGACGTCTGTCCTGCACCACAATAA) and R2 (CTCGAGTTAGTGGTGGTGGTGGTGGTGGTTATAAGGGGGCTTGCAGACGGGG) containing restriction endonuclease Nde I and Xho I restriction sites were designed to amplify the coding Crustin-2 by PCR The gene fragment of the mature peptide was reacted in a PTC-100 Programmable Thermal Crontroller cycler (MJ Research). The reaction conditions were: pre-denaturation at 94°C for 5 minutes; then 35 cycles including denaturation at 94°C for 30 seconds and annealing at 60°C for 30 seconds. 72°C extension for 30 seconds; final 72°C extension for 10 minutes. Then clone it into the pET30a(+) expression vector, transform Escherichia coli origami(DE3), after sequencing to confirm the expression frame is correct, inoculate the positive clone into LB medium, shake and culture at 37°C until O.D. 600 = 0.4-0.6, add IPTG to a final concentration of 1 mM and induce for 4 hours to collect th...

Embodiment 3

[0059] Implementation Example 3: Application of recombinant expression products in pharmaceutical production, feed additives, preservatives and fresh-keeping agents.

[0060] Chinese mitten crab Crustin-2 gene and its recombinant expression in vitro

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of molecular biology, in particular gene clone of Eriocheir sinensis Crustin-2 and recombinant expression technology. The invention uses an expressed sequence tag (EST) technique and 5' and 3' tail end rapid amplification technique (RACE) to clone a Crustin-2 gene from Eriocheir sinensis, wherein the cDNA has a full length of 1,255 bp comprising a 339p pen reading frame to code 112 amino acids, and the gene plays an important role in immune defense of the Eriocheir sinensis. A recombinant Crustin-2 protein has remarkable gram-positive bacterium antibacterial activity, has the minimum bacteriostatic concentrations of 0.093 mu M, 0.19 mu M, 0.37 mu M and 0.093 mu M to Micrococcus luteus, Bacillus subtilis, Mlicrococcus tetragenus and Bacillus thuringiensis respectively, and has no obvious antibacterial activity to a gram-negative bacterium. The invention can provide a foundation for the further research on the immune defense mechanism of the Eriocheir sinensis, and lays a foundation for disease control, gene-assisted breeding and feed additive development of the Eriocheir sinensis.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to the gene sequence of the Chinese mitten crab Crustin-2, specifically screens the EST sequence related to the Chinese mitten crab Crustin-2 from a cDNA library of the Chinese mitten crab, and splices it into a complete sequence , and then prokaryotic recombinant expression of Crustin-2 and identification of the corresponding antibacterial activity. The invention relates to the application of the Crustin-2 gene and its expression product in the production of medicines, feed additives, preservatives and fresh-keeping agents. Background technique [0002] Antimicrobial peptides are amphipathic small molecular basic polypeptides that widely exist in the biological world, and are key factors in the body's innate immunity. After Steiner first discovered in celestial silkworm, so far, more than 800 kinds of antimicrobial peptides have been found in various organisms. According ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C07K14/435A61K38/17A61P31/04A23K1/16A23L3/3526A23K20/147
Inventor 宋林生郑沛林母昌考赵建民王玲玲邱丽梅盖云超
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI