Eriocheir sinensis Crustin-2 gene and application of recombinant protein thereof
A Chinese mitten crab, gene technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve various problems such as serious diseases and loss of breeding industry
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0011] The cDNA sequence cloning and in vitro recombinant expression of Chinese mitten crab Crustin-2 in the present invention comprise the following steps:
[0012] a) Extraction of total RNA of Eriocheir sinensis and purification of mRNA;
[0013] b) Construction of cDNA library of Chinese mitten crab;
[0014] c) Large-scale determination of the EST sequence of the Chinese mitten crab cDNA library;
[0015] d) Homology analysis of EST sequence of Chinese mitten crab and screening of Crustin-2 gene fragment;
[0016] e) EST sequence splicing to obtain the full sequence of Crustin-2;
[0017] f) In vitro recombinant expression and activity analysis of Chinese mitten crab Crustin-2.
[0018] The specific operation is as follows:
[0019] 1. Extraction of total RNA of Chinese mitten crab and purification of mRNA: Total RNA was extracted from hemolymph of Chinese mitten crab infected with Vibrio anguillarum using Trizol reagent from Invitrogen Company, and mRNA was purified ...
Embodiment 2
[0058] According to the cDNA sequence corresponding to SEQ ID NO.2, specific primers F2 (CATATGACGTCTGTCCTGCACCACAATAA) and R2 (CTCGAGTTAGTGGTGGTGGTGGTGGTGGTTATAAGGGGGCTTGCAGACGGGG) containing restriction endonuclease Nde I and Xho I restriction sites were designed to amplify the coding Crustin-2 by PCR The gene fragment of the mature peptide was reacted in a PTC-100 Programmable Thermal Crontroller cycler (MJ Research). The reaction conditions were: pre-denaturation at 94°C for 5 minutes; then 35 cycles including denaturation at 94°C for 30 seconds and annealing at 60°C for 30 seconds. 72°C extension for 30 seconds; final 72°C extension for 10 minutes. Then clone it into the pET30a(+) expression vector, transform Escherichia coli origami(DE3), after sequencing to confirm the expression frame is correct, inoculate the positive clone into LB medium, shake and culture at 37°C until O.D. 600 = 0.4-0.6, add IPTG to a final concentration of 1 mM and induce for 4 hours to collect th...
Embodiment 3
[0059] Implementation Example 3: Application of recombinant expression products in pharmaceutical production, feed additives, preservatives and fresh-keeping agents.
[0060] Chinese mitten crab Crustin-2 gene and its recombinant expression in vitro
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap