Hydrogen-producing engineering bacteria and application thereof
A technology of engineering bacteria and fragments, applied in bacteria, fungi, introducing foreign genetic material using vectors, etc., can solve the problem of no reports on genes, and achieve the effect of improving hydrogen production capacity and strong substrate utilization capacity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1, the acquisition of Enterobacter aerogenes E.aerogenes IAM1183-A
[0046] The starting strain Enterobacter aerogenes (E. aerogenes IAM1183) was purchased from the strain bank of the Institute of Applied Microbiology (IAM), University of Tokyo, Japan.
[0047] Sequence analysis was performed on the Enterobacter aerogenes gene sequence (Genbank NO: EF601125) in NCBI, and a pair of primers hycA-Km-fw and hycA-Km-rv were designed. The sequences of hycA-Km-fw and hycA-Km-rv are as follows :
[0048] hycA-Km-fw:
[0049] 5'- CTGCAATTCGCTGGTTCAGGGCATCACCCTGTCAAAAGCG ATAGGCTCCGCCCCCCTGA-3';
[0050] hycA-Km-rv:
[0051] 5'- GGCTTAAATCCACCGGCTGGTCGTGTTCCATGGCGTCATA CAGGTGGCACTTTTCGGGG-3'.
[0052] The underlined sequences in the primers are the homology arms of E. aerogenes IAM1183 ΔhycA.
[0053] Transformation of pYM-red plasmid (Yu Mei, Zhou Jianguang, Chen Wei, Li Shanhu, Huang Cuifen, establishment of a transferable recombinant engineering system pYM-Red....
Embodiment 2
[0059] Embodiment 2, the growth characteristics of engineering bacteria and the determination of hydrogen production performance
[0060] In a 70mL serum bottle, 20mL of glucose medium was placed, and the activated engineering bacteria E.aerogenesIAM1183-A was cultured in a shake flask; at the same time, the activated wild bacteria were cultured in a shake flask under the same conditions as a control. The specific operation steps are as follows:
[0061] (1) Seed culture: use a 15ml centrifuge tube with 5ml of LB medium, inoculate from a solid plate, cultivate overnight at a temperature of 37°C and an air bath shaker at a speed of 170rpm.
[0062] (2) Anaerobic shake flask culture: adopt 70ml serum bottle anaerobic culture bottle, glucose medium filling capacity 20ml (use the air in the top of culture bottle and culture medium in advance with nitrogen replacement); The inoculation amount of seed bacteria 2.5% (v / v), the culture temperature is 37° C., and the rotation speed o...
Embodiment 3
[0069] Embodiment 3, the metabolic flow analysis of engineering bacteria
[0070] In order to determine the changes brought about by the knockout of the hycA gene on the strain, the distribution of each metabolic flux in the cells of wild bacteria and engineered bacteria was detected respectively. The specific steps are as follows:
[0071] (1) Seed cultivation: use a 15ml centrifuge tube with 5ml of LB medium, inoculate bacteria from a solid plate, cultivate overnight at a temperature of 37°C and an air bath shaker at a speed of 170rpm.
[0072] (2) Anaerobic shake flask culture: adopt 70ml serum bottle anaerobic culture bottle, glucose medium filling capacity 20ml (use the air in the top of culture bottle and culture medium in advance with nitrogen replacement); The inoculation amount of seed bacteria 2.5% (v / v), the culture temperature is 37° C., and the rotation speed of the air bath shaker is 170 rpm. Incubate for 16 hours.
[0073] (3) Metabolites were detected after ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 