Escherichia coli strain for recombined engineering

A technology of Escherichia coli and recombinant engineering, applied in the field of genetic engineering, can solve the problem of keeping the temperature uniform and difficult to control, and achieve the effect of rapid growth and high efficiency

Inactive Publication Date: 2010-01-27
NANJING NORMAL UNIVERSITY
View PDF0 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The integrated DY380 requires a 42°C water bath for 15 minutes of thermal induction, which adds additional operations, the main thing is to keep the temperature uniform and sometimes difficult to control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Escherichia coli strain for recombined engineering
  • Escherichia coli strain for recombined engineering
  • Escherichia coli strain for recombined engineering

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0087] The process of Escherichia coli LS-GR construction of the present invention is as follows:

[0088] 1. Preparation of Escherichia coli DH10B electroporation competent and DNA transformation

[0089] Inoculate a freshly streaked single colony from the plate into 2ml LB liquid medium and shake overnight at 37°C, then transfer to 50ml LB at 1 / 50 volume, and shake until the cell OD 600 About 0.6. Pour the bacterial solution into a pre-cooled centrifuge tube, place in an ice bath for 10 minutes, centrifuge at 5000 rpm for 5 minutes at 4°C, and discard the supernatant. The precipitate was washed twice with 10% glycerol, and finally suspended in 200 μl of 10% glycerol, and distributed in 50 μl per tube.

[0090] Add the DNA to 50 μl of ice-thawed DH10B electroporation-competent cells, flick and mix well. The mixture was transferred to a pre-cooled 1mm electroporation cuvette on ice, and transformed by electric shock. Electroporation conditions: 1mm electroporation cup, 2...

Embodiment 2

[0153] Such as Figure 4 As shown in the schematic diagram of the experimental process, this patent is to test the function of the recombinant engineering of Escherichia coli LS-GR, and the plasmid pACYC184 ( Figure 5 ) on the tetracycline resistance gene (Tc) was replaced by the kanamycin resistance gene (neo), and the resulting new plasmid was named pAEN ( Image 6 ).

[0154] 1. Amplification of the kanamycin resistance gene (neo) with a homology arm

[0155] Design primers:

[0156] AEN1: 5′- ATGTTTGACAGCTTATCATCGATAAGCTTTAATGCGGTAGTTTATCACAG TATGGACAGCAAGCGAACCGG-3' (SEQ ID NO. 17)

[0157] AEN2: 5′- TTGATTGGCTCCAATTCTTGGAGTGGTGAATCCGTTAGCGAGGTGCCGCC TCAGAAGAACTCGTCAAGAAG-3' (SEQ ID NO. 18)

[0158] The first 50 bases of the primer are the homology arms (underlined) at both ends of the Tc gene on the pACYC184 plasmid, and the following bases are the two ends of the neo gene on the pKD4 plasmid.

[0159] A 0.8 kb neo gene was amplified by PCR using the pKD4 tem...

Embodiment 3

[0170] Using the function of recombination engineering of Escherichia coli LS-GR, the single-copy plasmid pECBAC1 ( Figure 12 ) The chloramphenicol resistance gene (Cm) was replaced by the kanamycin resistance gene (neo), and the resulting new plasmid was named pBACN ( Figure 13 ).

[0171] 1. Amplification of the kanamycin resistance gene (neo) with a homology arm

[0172] Design primers:

[0173] CEN1: 5′- TAAGGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACT C TATGGACAGCAAGCGAACCGG-3' (SEQ ID NO.19)

[0174] CEN2: 5′- GCGTATTTTTTGAGTTATCGAGATTTTCAGGAGCTAAGGAAGC TAAAATG TCAGAAGAACTCGTCAAGAAG-3' (SEQ ID NO. 20)

[0175] The first 50 bases of the primer are the homology arms (underlined) at both ends of the Cm gene on the pECBAC1 plasmid, and the following bases are the two ends of the neo gene on the pKD4 plasmid.

[0176] A 0.8 kb neo gene was amplified by PCR using the pKD4 template, detected by electrophoresis on 1% agarose gel, and the PCR product was precipita...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to escherichia coli CGMCC NO.3192 for recombined engineering and a variant thereof. The strain is obtained by integrating gene segments subjected to the recombined engineering, i.e. a regulatory gene araC of the Arabinose ara operon from the escherichia coli, a promoter pBAD of the Arabinose ara operon from the escherichia coli, recombined enzyme genes red alpha, red alpha beta and gam from a gamma bacteriophage, a gene recA and gentamicin resistance gene (Gm) from the escherichia coli, into an endA gene area of a gene group of the escherichia coli DH10B, wherein red alpha, red alpha beta, gam and recA are driven by pBAD induced by arabinose. The recombined enzyme can catalyze homologous recombination among DNA short segments to finish the recombined engineering. The length of the DNA segment is about 50 base pairs. The invention has convenient operation of carrying out the recombined engineering by the strain and high recombined efficiency, thereby becoming the universal strain for the recombined engineering.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to an Escherichia coli used for recombinant engineering. Background technique [0002] Recombination engineering refers to a relatively novel gene cloning method for gene cloning or DNA transformation in Escherichia coli by homologous recombination between short DNA fragments catalyzed by recombinase. Recombination engineering has great advantages when conventional gene cloning methods are difficult or inefficient. For example, when the DNA fragment to be cloned is too large, it is difficult to find a suitable enzyme cutting site, it is difficult to perform gel recovery, the yield of PCR amplification is low, and it is easy to introduce mismatched bases; Gene mutations may also occur. Recombination engineering avoids these steps and has gradually become a routine cloning method. [0003] The recombinases in recombination engineering are mainly derived from three genes of lambda...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12R1/19
Inventor尚广东宋杰黄慧颖
OwnerNANJING NORMAL UNIVERSITY