Fowlpox virus vector shuttle plasmid and application thereof

A technology for shuttle plasmids and fowlpox virus, which is applied in the fields of application, genetic material components, and cells modified by introducing foreign genetic material, etc., to achieve the effects of simplified screening procedures, high-efficiency expression, and shortened screening cycles

Inactive Publication Date: 2010-07-14
MILITARY VETERINARY RES INST PLA MILITARY MEDICAL ACAD OF SCI
View PDF0 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is currently no fowlpox virus vector shuttle plasmid that is easy to screen and capable of high-efficiency expression of multiple genes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fowlpox virus vector shuttle plasmid and application thereof
  • Fowlpox virus vector shuttle plasmid and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 Construction of Fowlpox Virus Vector Shuttle Plasmid pTGP3

[0020] 1. Cloning of the TKL and TKR recombination arms of the fowlpox virus vector shuttle plasmid

[0021] According to the complete gene sequence of fowlpox virus registered in GenBank (NC002188), following the basic principles of primer design, the following 2 pairs of primers were analyzed, designed, and screened to amplify TKL and TKR respectively:

[0022] TKLSp: CGTTAATTAAACGGGATCATACGCAGACAG

[0023] TKLASp: GCTCTAGATAGGATCCGATATCGCCGTAGCTCTCATAAACAATA

[0024] TKRSp: CGAGATCTCGCGCTTAACGGTGATTT

[0025] TKRASp: GCACTAGTTGCGTTATTATTACATTTACTTTG

[0026] Optimize the reaction conditions of each step and the optimal concentration of the reagents involved in the reaction, and use the fowlpox virus genome as a template to perform DNA amplification on a PCR machine. The total reaction volume is 50 μL (5 μL of 10×PCR buffer, 1 μL of each 20 μmol / L primer pair, 5 μL of template DNA, 5 μL of dNTP...

Embodiment 2

[0033] Example 2 Recombinant fowl pox virus

[0034] 1. Toxicity determination of fowl pox virus

[0035] fowl pox virus by 10 2 -10 6 Chicken embryo fibroblasts grown on a 6×30mm culture plate were inoculated with dilution multiples, supplemented with MEM containing 1% methylcellulose and 1% fetal calf serum (FCS) as a maintenance solution, 37°C, 5% CO 2 After culturing under the conditions for 120 hours, the culture medium was discarded, washed twice with PBS (pH7.2), fixed with 1% formaldehyde at room temperature for 15 min, washed with water, stained with 0.1% crystal violet for 5 min, washed with water, counted the number of virus plaques to calculate the Plaque forming units (PFU) contained in a milliliter of virus fluid. The formula for calculating PFU is as follows:

[0036] PFU=(number of virus plaques×dilution factor) / infection volume (ml)

[0037] 2. Intracellular homologous recombination

[0038] Inoculate passaged chicken embryo fibroblasts 1×10 in a 6×30mm ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides fowlpox virus vector shuttle plasmid pTGP3 which comprises recombinant arms TKL and TKR, a bidirectional promoter PE / L, a fluorescent protein expression cassette, and a resistant marker gene and replication origin ori; the upstream and the downstream of the bidirectional promoter PE / L are respectively provided with cloning sites MCSL and MCSR; and both ends of the fluorescent protein expression cassette are provided with loxp sequences. The plasmid of the invention has two different screening markers, and the recombinant fowlpox virus prepared with the plasmid can express 1 to 3 types of gene with different meshes in the whole processes of the early and the later periods; the strong composite promoter with expression activity in the early and the later periods is applied so as to realize the all-process high-efficiency expression of a target gene; and the loxp sequences are introduced into both ends of the fluorescent protein expression cassette, so as to knock out the exogenous recombinant fowlpox virus screening markers. The invention lays foundation for the series and the scale application of the recombinant fowlpox virus in vaccine and biological drug research and development fields.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a fowlpox virus vector shuttle plasmid, which can be used in the research, development and utilization of vaccines. Background technique [0002] The eradication of smallpox was the greatest achievement in the history of human medicine, and poxvirus played a decisive role in this process. With the development of molecular biology techniques, the application of poxviruses in the fields of medicine and biology continues to deepen. Especially since the use of vaccinia virus as a vector to successfully express foreign antigens in 1982, poxviruses such as vaccinia virus and fowlpox virus have been widely used in the development of genetically engineered live vector vaccines and biological drugs. In 1987, the recombinant vaccinia virus expressing the rabies virus G gene was first approved for use in wild animals, and successfully controlled wild animal rabies in Europe and Nor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/863C12N5/10A61K48/00
Inventor金宁一李霄李昌鲁会军田明尧金扩世陈漉刘妍高鹏杨恩成
OwnerMILITARY VETERINARY RES INST PLA MILITARY MEDICAL ACAD OF SCI