Fowlpox virus vector shuttle plasmid and application thereof
A technology for shuttle plasmids and fowlpox virus, which is applied in the fields of application, genetic material components, and cells modified by introducing foreign genetic material, etc., to achieve the effects of simplified screening procedures, high-efficiency expression, and shortened screening cycles
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1 Construction of Fowlpox Virus Vector Shuttle Plasmid pTGP3
[0020] 1. Cloning of the TKL and TKR recombination arms of the fowlpox virus vector shuttle plasmid
[0021] According to the complete gene sequence of fowlpox virus registered in GenBank (NC002188), following the basic principles of primer design, the following 2 pairs of primers were analyzed, designed, and screened to amplify TKL and TKR respectively:
[0022] TKLSp: CGTTAATTAAACGGGATCATACGCAGACAG
[0023] TKLASp: GCTCTAGATAGGATCCGATATCGCCGTAGCTCTCATAAACAATA
[0024] TKRSp: CGAGATCTCGCGCTTAACGGTGATTT
[0025] TKRASp: GCACTAGTTGCGTTATTATTACATTTACTTTG
[0026] Optimize the reaction conditions of each step and the optimal concentration of the reagents involved in the reaction, and use the fowlpox virus genome as a template to perform DNA amplification on a PCR machine. The total reaction volume is 50 μL (5 μL of 10×PCR buffer, 1 μL of each 20 μmol / L primer pair, 5 μL of template DNA, 5 μL of dNTP...
Embodiment 2
[0033] Example 2 Recombinant fowl pox virus
[0034] 1. Toxicity determination of fowl pox virus
[0035] fowl pox virus by 10 2 -10 6 Chicken embryo fibroblasts grown on a 6×30mm culture plate were inoculated with dilution multiples, supplemented with MEM containing 1% methylcellulose and 1% fetal calf serum (FCS) as a maintenance solution, 37°C, 5% CO 2 After culturing under the conditions for 120 hours, the culture medium was discarded, washed twice with PBS (pH7.2), fixed with 1% formaldehyde at room temperature for 15 min, washed with water, stained with 0.1% crystal violet for 5 min, washed with water, counted the number of virus plaques to calculate the Plaque forming units (PFU) contained in a milliliter of virus fluid. The formula for calculating PFU is as follows:
[0036] PFU=(number of virus plaques×dilution factor) / infection volume (ml)
[0037] 2. Intracellular homologous recombination
[0038] Inoculate passaged chicken embryo fibroblasts 1×10 in a 6×30mm ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap