Fusion protein polymer

A technology of fusion protein and multimer, which is applied in the direction of hybrid peptide, introduction of foreign genetic material by using carrier, and cells modified by introducing foreign genetic material, which can solve the problems of low affinity and limited utilization, and achieve improved affinity and cost Low, high expression effect

Inactive Publication Date: 2010-09-15
北京表源生物技术有限公司
View PDF4 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0012] On the other hand, since the single-domain antibody only contains one antigen recognition and binding unit, its affinity is lower than that of traditional antibodies, which limits its clinical application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein polymer
  • Fusion protein polymer
  • Fusion protein polymer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Preparation and Verification of Single Region Antibody Pentameric Protein

[0039] 1. Clone MT1COMP and MT1S:

[0040] MT1 was fused with COMP to make a pentameric (method see figure 1 ), first use the PCR method to amplify the gene fragment expressing MT1, and the primers used are:

[0041] MT1F: 5′ TAATAAGAAGACCGCAGGCCGATGTGCAGCTGCAGGCGTCTGG 3′; sdAbR: 5′ ATTATTATGGGCCCTGAGGAGACGGTGACCTGGGT 3′

[0042] Template: phage expressing MT1 (Beijing Episource Biotechnology Co., Ltd.)

[0043] Reaction system: 10×pfu buffer 10μl, pfu 1μl, dNTP 8μl, MT1F 20μl, sdAbR 20μl, template 1μl, H 2 O 40 μl.

[0044] Reaction program: 94°C 5min; 94°C 30s, 60°C, 30s, 72°C 40s, 30 cycles; 72°C 10min

[0045] There are Bbs I and Apa I restriction sites at both ends, and after digestion and digestion, pVT2 digested with Bbs I and Apa I (Zhang et al., J Mol Biol, 335, 2004, 49-56) was inserted to obtain plasmid MT1VT1B. Then PCR amplifies the COMP fragment, and the primers use...

Embodiment 2

[0061] Antigen specificity experiment of embodiment 2MT1COMP pentamer fusion protein

[0062] Antigen specificity of MT1COMP was analyzed by ELISA.

[0063] 1) Preparation of biotinylated bovine serum albumin and HLA-A2 complex:

[0064] Biotinylated bovine serum albumin (BSA-biotin) was obtained by labeling BSA with sulfo-NHS-LC-Biotin (pierce, Rockford), and the specific operation was strictly in accordance with the instructions provided by the manufacturer. Biotinylated HLA-A2 complexes were prepared according to the relevant steps in the preparation of HLA-A2 complex tetramers by Dirk Busch (http: / / www.mikrobio.med.tu-muenchen.de / category / laboratory-group -busch / ) (the method is as follows: first express HLA-A2 and β in Escherichia coli 2 Inclusion bodies of m (HLA-A2 and β 2 The m gene is provided by Beijing Table Source), after purification, with different polypeptides (HLA-A2 restriction, including: MART-1 (ELAGIGILTV), gp100 (IMDQVPESV), CMV (NLVPMVATV), FLU (GILGFV...

Embodiment 3

[0073] Example 3 Affinity experiment of MT1COMP pentameric fusion protein

[0074] Adopt surface plasmon resonance (surface plasmon resonance, SPR) technique to measure MT1COMP pentamer fusion protein, the affinity of MT1S, detection equipment is Biacore 3000 (Biacore AB company, Sweden), used chip is Sensor chipSA (BiacoreAB company, Sweden), The chip was prepared according to the instructions provided by the manufacturer, and PBST was used as the running buffer throughout the process. Add the biotinylated MART-1-HLA-A2 complex, and at the same time add the biotinylated gp100-HLA-A2 complex to another channel to calculate the background during detection. See Figure 5 for the fixed density of the complex illustrate. MT1S set five concentration gradients 0.125μM, 0.25μM, 0.5μM, 1μM, 2μM, flowing through the chip from low to high, between the two concentrations with 10mM borate buffer (PH8.5, containing 1M NaOH and 0.1% Tween-20) regenerates the surface of the HLA-A2 complex. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a fusion protein polymer. The fusion protein polymer consists of a component A and a component B, wherein the component A is a single domain antibody, while the component B is peptide sequences which perform multimerization on fusion protein and are derived from TNF alpha protein, ACRP30 protein, P53 protein, COMP protein, C4BP protein and mutants of the TNF alpha protein, the ACRP30 protein, the P53 protein, the COMP protein and the C4BP protein. The fusion protein polymer has the advantages of successful expression in Escherichia coli, high expression quantity, relatively simple preparation and low cost. Poly-antibodies of the fusion protein polymer have high dissolubility and biological activity and greatly improve the affinity of antibody protein. The fusion protein polymer can be prepared into various biotech products such as diagnostic reagents used for diagnosing melanoma and the like, and used for target treatment of the melanoma and the like by carrying a therapeutic medicament. When the poly-antibodies based on the fusion protein polymer are clinically applied, the problem of strong immunogenicity can be solved.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a multivalent recombinant antibody. Background technique [0002] "Targeted therapy" is based on the different specific sites of the tumor, and anti-tumor drugs are targeted to act on it to kill tumor cells, while having little effect on normal tissues. This is the most ideal treatment mode at present. "Targeted therapy" includes many different strategies, which can be mainly divided into two categories: direct and indirect. [0003] Direct strategies refer to directly altering signaling when targeting tumor-associated or specific proteins, including antibody binding to relevant antigens or interfering with these proteins with small-molecule drugs. For example, epidermal growth factor receptor (EGFR) and vascular endothelial growth factor receptor (VEGFR) are closely related to the proliferation, growth, invasion, and metastasis of tumor cells, and both of them are highly expressed...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21
Inventor孙美艺朱学锴刘小立
Owner北京表源生物技术有限公司