Expression plasmid adjuvant for enhancing chemotherapeutic effect of tumor chemotherapeutics and preparation method thereof

A chemotherapeutic drug and plasmid technology is applied in the field of biomedicine to achieve the effects of improving sensitivity, improving chemotherapeutic effect and enhancing chemotherapeutic effect.

Inactive Publication Date: 2011-01-26
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] So far, there is no report on the research and application of an expression plasmid adjuvant expressing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression plasmid adjuvant for enhancing chemotherapeutic effect of tumor chemotherapeutics and preparation method thereof
  • Expression plasmid adjuvant for enhancing chemotherapeutic effect of tumor chemotherapeutics and preparation method thereof
  • Expression plasmid adjuvant for enhancing chemotherapeutic effect of tumor chemotherapeutics and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1: Construction of recombinant plasmid PKLO-anti-miR23a

[0031] Design expression miR-23a inhibitor sequence with neck loop structure:

[0032] Sense strand: 5′ CCGGTATCACATTGCCAGGGATTTCCCTCGAGGGAAATCCCTGGCAATGTGATTTTTTG 3′

[0033] Antisense strand: 5′AATTCAAAAAATCACATTGCCAGGGATTTCCCTCGAGGGAAATCCCTGGCAATGTGAT A 3′

[0034] Add cohesive ends that can match the end of the carrier and bind the enzyme cleavage site at both ends of the sequence, artificially synthesize the sequence with the neck loop structure, and resuspend the nucleotide sequence in double distilled water at a concentration of 1ug / ul. This tube nucleotide sequence is annealed into a duplex.

[0035] The annealing system is:

[0036] -5ul of Sense oligo

[0037] -5ul of Antisense oligo

[0038] -5ul of 10x NEB buffer 2

[0039] -35ul ddH2O

[0040] A total of 50ul of the system was incubated in a 95°C water bath for 4 minutes, in a beaker filled with 1500ml of water at 70°C for 10 minu...

Embodiment 2

[0041] Example 2: Large-scale preparation of the recombinant plasmid PKLO-anti-miR23a (using the plasmid large-scale extraction kit of Beyond Biotechnology Co., Ltd.)

[0042] 1. Take the overnight bacteria into a 50ml centrifuge tube, centrifuge at 5000g for 1 minute to collect the bacterial pellet, and discard the supernatant. Repeat again and collect a total of 100 mL of overnight bacterial pellet per tube.

[0043] 2. Add 5ml solution I to each tube to resuspend the bacterial pellet. Make sure the pellet is completely dispersed with no visible clumps of bacteria. Confirm that RNase A has been added to Solution I. Vortex at top speed for 10-20 seconds or more to suspend the pellet. It must be fully mixed, and it should be a uniform suspension when observed against a bright place, without obvious bacterial agglomerates or flocs. If there is no vortex instrument, you can blow the sediment with a gun to gradually disperse the sediment.

[0044] 3. Add 5 ml of solution II ...

Embodiment 3

[0057] Example 3: PLKO-anti-miR23a enhances the chemotherapy effect of chemotherapy drug 5-FU on colon cancer xenografts

[0058] 1. Establishment of xenograft model of human colon cancer cell line HCT116:

[0059] Will collect 1×10 7 HCT116 cells (purchased from the Chinese Academy of Sciences Cell Bank) were resuspended in serum-free medium and inoculated subcutaneously on the right back of 6-8 week immunodeficient mice. Tumors grew out 10 days after inoculation. 3 , the mice were randomly divided into three groups. A: Tail vein injection of 60 μl / monkey with PBS; B: tail vein injection of 60 μl / mouse of 5-FU+intratumoral injection of PLKO.1 empty plasmid; C: tail vein injection of 60 μl / mouse of 5-FU+intratumoral injection of PLKO-anti-miR23a expression plasmid.

[0060] Measure the length and width of the tumor every week, and apply the formula V=0.4×LW 2 To calculate the tumor volume, the plasmid and chemotherapy drug 5-FU were injected into the tail vein once a week....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the field of biomedicine. 5-fluorouracil (5-FU) is widely applied to the chemotherapy of gastral malignant tumors, but primary and acquired medicament resistant phenomena in the chemotherapy of colon cancer are universal; cell apoptosis is an important approach that chemotherapeutics play a role, and APAF-1 serving as regulatory protein is mainly involved in signal transduction of a mitochondrion approach of apoptosis; miR-23a can be combined with APAF1 serving as a target gene thereof so as to reduce the expression of the APAF1, and the apoptosis caused by the mitochondrion approach due to the chemotherapy is reduced so as to enhance the tolerance of the tumors to the chemotherapeutics; and the number of apoptotic cells is increased by reducing the expression amount of the in-vivo miR-23a so as to enhance the sensibility of the chemotherapeutics. The invention provides a PLKO-anti-miR-23a vaccine adjuvant for enhancing the chemotherapeutic effect of the chemotherapeutics, particularly the 5-FU. In-vitro experiments prove that the vaccine adjuvant can enhance the apoptosis level of colon cancer cells caused by the 5-FU serving as the chemotherapeutics obviously, and in-vivo experiments show that the vaccine adjuvant can enhance the chemotherapeutic effect of the 5-FU obviously, inhibit tumor growth and prolong the survival period of immunodeficient mice.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a PLKO-anti-miR-23a expression plasmid adjuvant for enhancing the chemotherapy effect of chemotherapy drugs and a preparation method thereof. Background technique [0002] 5-Fluorouracil (5-FU) is widely used in the chemotherapy of digestive tract malignancies. Because of its definite curative effect, it has always been irreplaceable by other chemotherapy drugs. However, some cases are not sensitive to this drug-based chemotherapy. 5-FU is a drug commonly used in the treatment of colorectal cancer, gastric cancer, and cholangiocarcinoma, and the effective rate of monotherapy is only about 20%. The combined use of chemotherapeutic drugs (such as: 5-FU + vincristine + semustine) can significantly improve the efficiency of chemotherapy for advanced colorectal cancer and significantly prolong the median survival time of patients. Nonetheless, primary and acquired resistance to colorectal ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K39/39A61K48/00A61K31/513C12N15/113C12N15/867A61P35/00
Inventor 孙树汉商京丽魏伟
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap