Chinese cabbage PHK4 protein coding sequence and functional verification thereof
A Chinese cabbage and sequence technology, applied to cells modified by introducing foreign genetic material, biochemical equipment and methods, applications, etc., can solve the problems of incomplete sequencing results of Chinese cabbage genome and unreported coding sequences
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0015] Isolation of Genomic Coding Sequence of Chinese Cabbage Cytokinin Receptor PHK4
[0016] Using the known cruciferous plant cytokinin receptor gene cDNA sequence, by comparison, a section of EST sequence of Chinese cabbage with high similarity was obtained, and primers were designed on it for reverse PCR amplification, and two EST sequences of the EST sequence were obtained. The unknown sequence on the side is further extended to one end through chromosome walking technology to amplify the unknown sequence at the 3' end, and then through comparison and analysis with the gene sequence library to find a sequence with high gene similarity, design primers on it, and pass The 5' end sequence was obtained by conventional PCR amplification, and a DNA sequence with a full length of 8474bp was obtained after splicing. This sequence comprises the genomic coding sequence of the PHK4 protein.
[0017] The detailed process is as follows:
[0018] 1. Circularization of plant genomic...
Embodiment 2
[0044] Cloning of CDS Sequence of Chinese Cabbage Cytokinin Receptor PHK4 Gene
[0045] 1. Isolation of total RNA from Chinese cabbage
[0046] Take fresh young leaves of Chinese cabbage, freeze them with liquid nitrogen, and grind them thoroughly. Transfer the sample powder into a 1.5ml centrifuge tube and add Trizol to extract total RNA.
[0047] 2. RT-PCR
[0048] The genomic coding sequence of the PHK4 protein obtained in Example 1 was analyzed by GENSCAN, and the CDS sequence of the gene was predicted. Design a pair of primers PHK4A-F and PHK4A-R on the predicted exon sequence, the sequence is:
[0049] PHK4A-F: GTTCACGCTTTGGCTATTCT (SEQ ID NO: 14)
[0050] PHK4A-R: CTTCCTTCTCCATCATCCTT (SEQ ID NO: 15)
[0051] The total RNA extracted from Chinese cabbage was used as a template, and PHK4A-F and PHK4A-R were used as primers to carry out RT-PCR reaction, and a 2065bp cDNA fragment was amplified. The amplified product was recovered, connected to the pMD19-T vector, tra...
Embodiment 3
[0065] Example 3 PHK4 can restore the response of yeast Δsln1 mutants to cytokinins
[0066] 1. Construction of yeast expression vector containing PHK4 gene
[0067] On the basis of obtaining the cDNA gene sequence of Chinese cabbage, design primers PHK4H-R (Not1) and 5′-229 (Spe1) introducing restriction endonuclease sites, and use Chinese cabbage cDNA as a template for PCR amplification. The amplified product was cloned into pMD19T-vector, and further cloned into yeast expression vector pCUY315 to construct pCUY315-3k yeast fusion expression vector.
[0068] PHK4H-R (Not1): ata aga atg cgg ccg cgg TACAAATCgAACTCCggT (SEQ ID NO: 22)
[0069] 5'-229 (Spe1): gga cta gt ATGGGTTTCGCCAAGATGCAGC (SEQ ID NO: 23)
[0070] 2. Transformation of yeast Δsln1 mutant strain TM182
[0071] Pick the single clone of yeast Δsln1 mutant strain TM182 in liquid YPD medium, culture overnight at 30°C and 160rpm to prepare competent yeast, and convert the constructed yeast expression vector pCUY3...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More