Bird flu vaccine by using attenuated vaccinia Tian Tan as vector

A technology of vaccinia virus and avian influenza virus, which is applied in the field of avian influenza vaccine and its preparation, can solve the problems of difficult supply, a large number of vaccines, and stimulation of effective neutralizing antibodies

Inactive Publication Date: 2011-08-03
高福 +1
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

A great possibility is that, like the H5 expression protein, the weak immunogenicity of the attenuated strain makes it difficult to stimulate the production of effective neutralizing antibodies in humans
In addition, reverse genetic technology is difficult to provide a large number of vaccines in a short period of time
Therefore, it is not optimistic that the current vaccine research will produce an effective anti-H5N1 vaccine in humans in the near future

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bird flu vaccine by using attenuated vaccinia Tian Tan as vector
  • Bird flu vaccine by using attenuated vaccinia Tian Tan as vector
  • Bird flu vaccine by using attenuated vaccinia Tian Tan as vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: Construction of a recombinant vaccinia virus transfer vector expressing the HA gene of avian influenza virus

[0038] RNA of H5N1 subtype avian influenza virus A / Bar-headed Goose / Qinghai / 1 / 05 strain (Jinhua Liu#, et al. Highly pathogenic H5N1 influenza virus infection in migra-tory birds. Science, 2005, 309: 1206) As a template, use synthetic primers (primer 1: 5'TTGGATCCATGGAGAAAATAGTGCT3'; primer 2: 5'GGCTCGAGTTAAATGCAAATTCTGC3'; where a BamH I restriction site is added to the 5' end of the primer 1 sequence, and an XhoI restriction site is added to the 5' end of the primer 2 sequence ), the HA gene is amplified by RT-PCR, and the amplified HA gene includes the complete reading frame of the HA gene.

[0039] Subcloning the amplified HA gene into pZC also digested with BamH I and Xho I through BamH I and Xho I restriction sites XZ Among the shuttle vectors (Huang, X., B. Lu, W. Yu, Q. Fang, L. Liu, K. Zhuang, T. Shen, H. Wang, P. Tian, ​​L. Zhang, and Z. Ch...

Embodiment 2

[0040] Example 2: Construction of recombinant vaccinia virus expressing avian influenza virus HA gene

[0041] The prepared chicken embryo fibroblasts were used to inoculate a six-well plate, and after 80% of the cells covered a monolayer, the vaccinia virus Tiantan strain (CCTCC: V200416) was inoculated with an inoculation volume of 0.5 MOI per well. Infect at 37°C for 2 hours, discard the infection solution, and rinse the cells three times with DMEM medium without antibiotics and calf serum; then use liposome Lipofectamin TM 2000 (purchased from Invitrogen Company) instructions, using the liposome method with 4 μg of purified recombinant transfer plasmid pZC XZ -HA transfected chicken embryo fibroblasts that had been infected with vaccinia virus Tiantan strain, infected at 37°C for 1 hour, discarded the transfection solution, and added DMEM culture solution containing 5% calf serum (both DMEM and calf serum were purchased from Invitrogen), 37°C, 5% CO 2 After culturing in...

Embodiment 3

[0044] Example 3: Efficacy of recombinant Tiantan vaccinia virus avian influenza vaccine inducing AIV-specific immunity in animals

[0045] 1. Protective research of different immunization pathways of vaccines

[0046] 1) Determination of antibody levels produced by vaccines

[0047] Six-week-old SPF Balb / c mice (purchased from Beijing Experimental Animal Center) were immunized by intramuscular injection, intranasal drip and oral administration, with a dose of 3.0×10 6 PFU (plaque forming unit, plaque forming unit), a total of two immunizations with an interval of 31 days. Blood was collected on days 0, 28 and 45 after the first immunization, and the levels of hemagglutination-inhibiting antibodies (HI) and trace neutralizing antibodies against H5N1 virus in serum were determined according to the method recommended by the World Organization for Animal Health (http: / / www.oie.int / Eng / Normes / Mmanual / A_00037.htm). It was found that the background serum of the mice (that is, th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a recombinant vaccinia virus expressing the hemagglutinin (HA) protein of H5N1 bird flu virus and the recombinant vaccinia virus can be used as the bird flu vaccine. Specifically, the bird flu vaccine is constructed on the basis of attenuated vaccinia Tian Tan (CCTCC: V200416). The invention provides a vector for constructing the bird flu vaccine. The invention also relates to an inoculation scheme by using the bird flu vaccine.

Description

technical field [0001] The invention relates to the field of biotechnology, and more specifically relates to an avian influenza vaccine based on a highly attenuated vaccinia virus Tiantan strain (CCTCC: V200416) as a carrier and a preparation method and application thereof. Background technique [0002] Avian Influenza (AI) is a kind of zoonotic infectious disease or disease syndrome caused by influenza A virus of Orthomyxoviridae family and genus Influenzavirus. In 1878, Perroncito first reported an outbreak of avian influenza in chicken flocks in Italy, known at the time as fowl plague. In 1901, Centannic and Sarunozzi believed that the disease was caused by "filterable" pathogens. It was not until 1955 that Schafer confirmed that fowl plague virus was actually type A bird flu virus. Avian influenza virus is now widely distributed in many domestic birds (including turkeys, chickens, guinea fowls, quails, partridges, ostriches, pheasants, geese and ducks, etc.) and wild b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/01C12N15/44A61K39/145A61K48/00A61P31/16C12R1/93
Inventor 高福陈志伟
Owner 高福
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap