Human ribosomal protein molecules hRrp15p and preparation method and application thereof
A human ribosomal protein and molecular technology, applied in the field of human ribosomal protein molecular research, can solve problems such as unclear determinants
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] pEGFP-hRrp15 vector construction:
[0065] 1) Design primers:
[0066] Primer 1: 5'-CCGGAATTCATGGCAGCCGCCGCTCCGGAC-3'
[0067] Primer 2: 5'-CCGCTCGAGTGTATCAGAGT CACTTGC-3';
[0068] 2), use the HeLa cDNA library [Jiang, 1998] as a template to PCR amplify the full length of hRrp15p cDNA: (50 μl system)
[0069]
[0070] 3) Purify the PCR product with the BioFlux PCR Product Purification Kit:
[0071] -Add 100μl PCR product to 200μl Binding buffer and mix well;
[0072] - Transfer all the mixture to the Spin Column:
[0073] -6000g, centrifuge for 1min, and discard the liquid in the tube:
[0074] - Add 650μl Wash buffer to the Spin Column. 12000g, 30-60s centrifugation;
[0075] - Repeat the previous step once;
[0076] -Centrifuge again at 12000g for 1min, then transfer the Spin Column to a sterile 1.5ml EP tube:
[0077] -Add 42μl 50°C preheated Elution buffer to the Spin Column, and let stand at room temperature for 1min;
[0078] - Centrifuge at 12000 g ...
Embodiment 2
[0124] Construction of Δ228-232 deletion mutant expression vector of hRrp15p
[0125]1) Design primers upstream: TTCACTTCAGTCTGTTTGGCGCTTGAAGCAGTCTCATTTG, downstream: CAAATGAGACTGCTTCAAGCGCCAAACAGACTGAAGTGA;
[0126] 2) Amplification control reaction system: (50μl system)
[0127]
[0128] 3) Amplification reaction system: (50μl system)
[0129]
[0130] 4) PCR reaction:
[0131] 95℃30s
[0132] 95℃30s
[0133] 55℃1min
[0134] 68℃6mins(1minute / kb of plasmamid length)
[0135] 18 cycles
[0136] 5) Take 1% electrophoresis sample of 5ul reaction solution to test the result
[0137] 6) DpnI digestion of the PCR product: add 1 μl of DpnI restriction enzyme (10 U / μl) to the sample tube and control tube, place at 37° C., and incubate for 1 hr.
[0138] 7) 5 ul equivalent control and amplified product were transformed into the competent strain TOP-10.
[0139] 8) Pick a single clone to extract the plasmid. (La Jolla, CA). All the above recombinant vectors were verifi...
Embodiment 3
[0141] Cell culture and transfection experiments
[0142] 1) At 37°C, 5% CO 2 Culture MCF 7 cells with RPMI-1640 containing 10% FBS in the incubator;
[0143] 2) Digest MCF7 adherent cells, prepare cell suspension 1~3×104 / 500 μl, transfer to each well of 24-well plate and store at 37°C, 5% CO 2 Cultivate overnight in the incubator;
[0144] 3) Add 0.5 μg plasmid and 1 μl Lipofectamine2000 (Invitrogen, Inc.) to 501 RPMI-1640 serum-free medium, and let stand at room temperature for 5 minutes;
[0145] 4) Mix the above two systems and let stand at room temperature for 20 minutes;
[0146] 5) Add the mixed system from the previous step to each well of the corresponding cells for culture, and use it for immunofluorescence staining or western blotting the next day.
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 