Human ribosomal protein molecules hRrp15p and preparation method and application thereof
A human ribosomal protein and molecular technology, applied in the field of human ribosomal protein molecular research, can solve problems such as unclear determinants
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] pEGFP-hRrp15 vector construction:
[0065] 1) Design primers:
[0066] Primer 1: 5'-CCGGAATTCATGGCAGCCGCCGCTCCGGAC-3'
[0067] Primer 2: 5'-CCGCTCGAGTGTATCAGAGT CACTTGC-3';
[0068] 2), use the HeLa cDNA library [Jiang, 1998] as a template to PCR amplify the full length of hRrp15p cDNA: (50 μl system)
[0069]
[0070] 3) Purify the PCR product with the BioFlux PCR Product Purification Kit:
[0071] -Add 100μl PCR product to 200μl Binding buffer and mix well;
[0072] - Transfer all the mixture to the Spin Column:
[0073] -6000g, centrifuge for 1min, and discard the liquid in the tube:
[0074] - Add 650μl Wash buffer to the Spin Column. 12000g, 30-60s centrifugation;
[0075] - Repeat the previous step once;
[0076] -Centrifuge again at 12000g for 1min, then transfer the Spin Column to a sterile 1.5ml EP tube:
[0077] -Add 42μl 50°C preheated Elution buffer to the Spin Column, and let stand at room temperature for 1min;
[0078] - Centrifuge at 12000 g ...
Embodiment 2
[0124] Construction of Δ228-232 deletion mutant expression vector of hRrp15p
[0125]1) Design primers upstream: TTCACTTCAGTCTGTTTGGCGCTTGAAGCAGTCTCATTTG, downstream: CAAATGAGACTGCTTCAAGCGCCAAACAGACTGAAGTGA;
[0126] 2) Amplification control reaction system: (50μl system)
[0127]
[0128] 3) Amplification reaction system: (50μl system)
[0129]
[0130] 4) PCR reaction:
[0131] 95℃30s
[0132] 95℃30s
[0133] 55℃1min
[0134] 68℃6mins(1minute / kb of plasmamid length)
[0135] 18 cycles
[0136] 5) Take 1% electrophoresis sample of 5ul reaction solution to test the result
[0137] 6) DpnI digestion of the PCR product: add 1 μl of DpnI restriction enzyme (10 U / μl) to the sample tube and control tube, place at 37° C., and incubate for 1 hr.
[0138] 7) 5 ul equivalent control and amplified product were transformed into the competent strain TOP-10.
[0139] 8) Pick a single clone to extract the plasmid. (La Jolla, CA). All the above recombinant vectors were verifi...
Embodiment 3
[0141] Cell culture and transfection experiments
[0142] 1) At 37°C, 5% CO 2 Culture MCF 7 cells with RPMI-1640 containing 10% FBS in the incubator;
[0143] 2) Digest MCF7 adherent cells, prepare cell suspension 1~3×104 / 500 μl, transfer to each well of 24-well plate and store at 37°C, 5% CO 2 Cultivate overnight in the incubator;
[0144] 3) Add 0.5 μg plasmid and 1 μl Lipofectamine2000 (Invitrogen, Inc.) to 501 RPMI-1640 serum-free medium, and let stand at room temperature for 5 minutes;
[0145] 4) Mix the above two systems and let stand at room temperature for 20 minutes;
[0146] 5) Add the mixed system from the previous step to each well of the corresponding cells for culture, and use it for immunofluorescence staining or western blotting the next day.
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com