Unlock instant, AI-driven research and patent intelligence for your innovation.

Human ribosomal protein molecules hRrp15p and preparation method and application thereof

A human ribosomal protein and molecular technology, applied in the field of human ribosomal protein molecular research, can solve problems such as unclear determinants

Inactive Publication Date: 2011-09-07
TIANJIN NORMAL UNIVERSITY
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the determinants of the nucleolar localization of nucleolin remain unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human ribosomal protein molecules hRrp15p and preparation method and application thereof
  • Human ribosomal protein molecules hRrp15p and preparation method and application thereof
  • Human ribosomal protein molecules hRrp15p and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] pEGFP-hRrp15 vector construction:

[0065] 1) Design primers:

[0066] Primer 1: 5'-CCGGAATTCATGGCAGCCGCCGCTCCGGAC-3'

[0067] Primer 2: 5'-CCGCTCGAGTGTATCAGAGT CACTTGC-3';

[0068] 2), use the HeLa cDNA library [Jiang, 1998] as a template to PCR amplify the full length of hRrp15p cDNA: (50 μl system)

[0069]

[0070] 3) Purify the PCR product with the BioFlux PCR Product Purification Kit:

[0071] -Add 100μl PCR product to 200μl Binding buffer and mix well;

[0072] - Transfer all the mixture to the Spin Column:

[0073] -6000g, centrifuge for 1min, and discard the liquid in the tube:

[0074] - Add 650μl Wash buffer to the Spin Column. 12000g, 30-60s centrifugation;

[0075] - Repeat the previous step once;

[0076] -Centrifuge again at 12000g for 1min, then transfer the Spin Column to a sterile 1.5ml EP tube:

[0077] -Add 42μl 50°C preheated Elution buffer to the Spin Column, and let stand at room temperature for 1min;

[0078] - Centrifuge at 12000 g ...

Embodiment 2

[0124] Construction of Δ228-232 deletion mutant expression vector of hRrp15p

[0125]1) Design primers upstream: TTCACTTCAGTCTGTTTGGCGCTTGAAGCAGTCTCATTTG, downstream: CAAATGAGACTGCTTCAAGCGCCAAACAGACTGAAGTGA;

[0126] 2) Amplification control reaction system: (50μl system)

[0127]

[0128] 3) Amplification reaction system: (50μl system)

[0129]

[0130] 4) PCR reaction:

[0131] 95℃30s

[0132] 95℃30s

[0133] 55℃1min

[0134] 68℃6mins(1minute / kb of plasmamid length)

[0135] 18 cycles

[0136] 5) Take 1% electrophoresis sample of 5ul reaction solution to test the result

[0137] 6) DpnI digestion of the PCR product: add 1 μl of DpnI restriction enzyme (10 U / μl) to the sample tube and control tube, place at 37° C., and incubate for 1 hr.

[0138] 7) 5 ul equivalent control and amplified product were transformed into the competent strain TOP-10.

[0139] 8) Pick a single clone to extract the plasmid. (La Jolla, CA). All the above recombinant vectors were verifi...

Embodiment 3

[0141] Cell culture and transfection experiments

[0142] 1) At 37°C, 5% CO 2 Culture MCF 7 cells with RPMI-1640 containing 10% FBS in the incubator;

[0143] 2) Digest MCF7 adherent cells, prepare cell suspension 1~3×104 / 500 μl, transfer to each well of 24-well plate and store at 37°C, 5% CO 2 Cultivate overnight in the incubator;

[0144] 3) Add 0.5 μg plasmid and 1 μl Lipofectamine2000 (Invitrogen, Inc.) to 501 RPMI-1640 serum-free medium, and let stand at room temperature for 5 minutes;

[0145] 4) Mix the above two systems and let stand at room temperature for 20 minutes;

[0146] 5) Add the mixed system from the previous step to each well of the corresponding cells for culture, and use it for immunofluorescence staining or western blotting the next day.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses specific nucleotide of human ribosomal protein molecules hRrp15p. The nucleotide comprises a) a nucleotide sequence shown as SEQ ID NO: 1 or a complementary DNA sequence thereof, and b) a nucleotide sequence formed by deletion, substitution or insertion of one or more bases in the a) and still having nucleotide function, wherein the full length of the nucleotide shown as SEQ ID NO: 1 is 849 bases. The amino acid sequence such as SEQ ID NO: 2 corresponding to the nucleotide sequence has 282 amino acids. Polyclonal antibodies of hRrp15p are prepared, and multiple mutants of the protein molecules are constructed; and intracellular expression of the hRrp15p, sub-cellular positioning and influence of the protein molecules on nucleolin nucleolus positioning are deeply researched. Therefore, the problem hollow to position the nucleolin in a nucleolus structure is solved, the formation of the nucleolus structure is promoted, and morphological basis is laid for exertion of functions of the nucleoli in cells.

Description

technical field [0001] The invention belongs to the technical field of human ribosomal protein molecular research, and relates to human ribosomal protein molecule hRrp15p determining nucleolin (Nucleolin) nucleolus location. More specifically, it is a human ribosomal protein molecule hRrp15p and its preparation method and application. Background technique [0002] With the rapid development of science and technology, people's exploration of life has also advanced rapidly, and many in-depth studies have been carried out on the occurrence of life. The important role of various substances is inseparable from the occurrence of life. The nucleolus is the most prominent structure in the interphase nucleus of eukaryotic cells. It has important functions and is the site of ribosomal RNA synthesis, processing and assembly of ribosomal subunits. Nucleolin (also known as C23) is the most important protein in the nucleolus of eukaryotic cells and has a variety of biological functions. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C07K14/435C12N15/79A61K48/00A61P35/00
Inventor 朱长军田明忠张而立张晓锋
Owner TIANJIN NORMAL UNIVERSITY