Primer, probe and method for detecting entomophily or contact transmission pathogens by using liquid phase chip

A liquid-phase chip detection and contact transmission technology, applied in the field of medical monitoring, can solve the problems of many materials required for detection, unfavorable diagnosis of virus infection, and long detection cycle

Inactive Publication Date: 2011-09-14
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF2 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The pathogen culture and isolation detection method is a traditional detection technology, the detection result is accurate and reliable, but the sensitivity is low, the detection cycle is long, which is not conducive to the early diagnosis of viral infection; the sensitivity and specificity of immunological detection are strong, but The detection requires

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

example １

[0093] It is known that sample 1 contains Japanese encephalitis virus (JEV), and it is detected by the method of the present invention, and the specific steps are as follows:

[0094] a. Extract the total DNA and RNA in the sample respectively;

[0095] b. Using the total sample DNA extracted in step a as a template, use adenovirus-specific PCR primers ADV-F and ADV-R, herpes simplex virus type I, and herpes simplex virus type II general-purpose PCR primer Herpes Virus-F The first round of PCR was performed with Herpes Virus-R. The sequences of each primer are as follows:

[0096] ADV-F: CTGGTCCGTACTTCCGAGCGARTGGKCDTACATGCACATC

[0097] ADV-R: TACAGTCGGTCGCGTGCCTCCGRTCBGTGGTCACRTCGTG

[0098] Herpes Virus-F: CTGGTCCGTACTTCCGAGCGGCTCGAGTGCGAAAAAACGTTC

[0099] Herpes Virus-R: TACAGTCGGTCGCGTGCCTCTGCGGTTGATAAACGCGCAGT.

[0100] c. Add the following substances to the PCR tube: 2.5uL of 10×PCR buffer, 0.5uL of four deoxyribonucleotides, 0.25uL of PCR primer F at a concentrati...

example 2

[0145] It is known that the sample contains dengue virus type I (DEN-1), and it is detected by the method of the present invention. The specific steps are the same as in Example 1. The results of the fluorescence detection value are as follows:

[0146] When the first round of PCR primer F and the first round of PCR primer R in step d are Japanese encephalitis virus primers JEV-F and JEV-R, and the probe of step h is Japanese encephalitis virus probe JEV-probe, the fluorescence The detection value is 414, confirming that the sample does not contain Japanese encephalitis virus;

[0147] When the first round of PCR primer F and the first round of PCR primer R in step d are dengue virus type I primers DEN 1-F and DEN 1-R, the probe in step g is dengue virus type I probe DEN 1 -probe, the fluorescence detection value is 915, confirming that the sample contains Dengue virus type I;

[0148] When the first round of PCR primer F and the first round of PCR primer R in step d are deng...

example 3

[0157] It is known that the sample contains dengue virus type II (DEN-2), and it is detected according to the method of the present invention. The specific steps are the same as in Example 1, and the results of the fluorescence detection value are as follows:

[0158] When the first round of PCR primer F and the first round of PCR primer R in step d are Japanese encephalitis virus primers JEV-F and JEV-R, and the probe of step h is Japanese encephalitis virus probe JEV-probe, the fluorescence The detection value is 479, confirming that the sample does not contain Japanese encephalitis virus;

[0159] When the first round of PCR primer F and the first round of PCR primer R in step d are dengue virus type I primers DEN 1-F and DEN 1-R, the probe in step g is dengue virus type I probe DEN 1 -probe, the fluorescence detection value is 15, confirming that the sample does not contain dengue virus type I;

[0160] When the first round of PCR primer F and the first round of PCR prime...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a primer, a probe and a method for detecting entomophily or contact transmission pathogens by using a liquid phase chip, which are used for detecting nine clinical common entomophily or contact transmission infectious disease pathogens. The invention can detect the nine clinical common entomophily or contact transmission infectious disease pathogens based on an MASA (multi-analyte suspension array) liquid phase chip technology, homology analysis is performed respectively according to all nucleotide sequences of 9 target viruses which can be retrieved in a gene bank mainly, the degenerate primer and the specific probe are designed, two turns of PCR (polymerase chain reaction) and molecular hybridization are further performed, and a Luminex100 system is further usedfor detection, thereby determining types of the pathogens contained in the sample. The invention is most important for adopting a correct treatment scheme and timely taking measures for preventing disease transmission by detection and early diagnosis of the 9 clinical common entomophily or contact transmission infectious disease pathogens. The invention has the advantages of fast detection speed,simpleness in operation, high sensitivity, good specificity and the like, and is conductive to popularization.

Description

technical field [0001] The invention relates to the detection of 9 common clinical insect vectors or contact-transmitted infectious disease pathogens, especially a method for detecting 9 clinical common insect vectors or contact-transmitted infectious disease pathogens by means of a liquid phase chip, which belongs to The field of medical monitoring technology. Background technique [0002] Japanese encephalitis virus (JEV), Dengue virus type I (DEN-1), Dengue virus type II (DEN-2), Dengue virus type III (DEN-3), Dengue virus IV Enterovirus type (DEN-4), enterovirus EV71, adenovirus (ADV), herpes simplex virus type 1 (Herpes virus 1) and herpes simplex virus type 2 (Herpes virus 2) are the nine major clinically common human infections in my country. disease pathogen. Among them, Japanese encephalitis virus, dengue fever I-IV and enterovirus EV71 are statutory B infectious diseases. These nine pathogens are mainly transmitted through contact or insect vectors, which can easi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68
CPCY02A50/30
Inventor 王华林尹飞飞邓菲胡志红袁勤芬
Owner WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap