Primer, probe and method for detecting entomophily or contact transmission pathogens by using liquid phase chip
A liquid-phase chip detection and contact transmission technology, applied in the field of medical monitoring, can solve the problems of many materials required for detection, unfavorable diagnosis of virus infection, and long detection cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
example 1
[0093] It is known that sample 1 contains Japanese encephalitis virus (JEV), and it is detected by the method of the present invention, and the specific steps are as follows:
[0094] a. Extract the total DNA and RNA in the sample respectively;
[0095] b. Using the total sample DNA extracted in step a as a template, use adenovirus-specific PCR primers ADV-F and ADV-R, herpes simplex virus type I, and herpes simplex virus type II general-purpose PCR primer Herpes Virus-F The first round of PCR was performed with Herpes Virus-R. The sequences of each primer are as follows:
[0096] ADV-F: CTGGTCCGTACTTCCGAGCGARTGGKCDTACATGCACATC
[0097] ADV-R: TACAGTCGGTCGCGTGCCTCCGRTCBGTGGTCACRTCGTG
[0098] Herpes Virus-F: CTGGTCCGTACTTCCGAGCGGCTCGAGTGCGAAAAAACGTTC
[0099] Herpes Virus-R: TACAGTCGGTCGCGTGCCTCTGCGGTTGATAAACGCGCAGT.
[0100] c. Add the following substances to the PCR tube: 2.5uL of 10×PCR buffer, 0.5uL of four deoxyribonucleotides, 0.25uL of PCR primer F at a concentrati...
example 2
[0145] It is known that the sample contains dengue virus type I (DEN-1), and it is detected by the method of the present invention. The specific steps are the same as in Example 1. The results of the fluorescence detection value are as follows:
[0146] When the first round of PCR primer F and the first round of PCR primer R in step d are Japanese encephalitis virus primers JEV-F and JEV-R, and the probe of step h is Japanese encephalitis virus probe JEV-probe, the fluorescence The detection value is 414, confirming that the sample does not contain Japanese encephalitis virus;
[0147] When the first round of PCR primer F and the first round of PCR primer R in step d are dengue virus type I primers DEN 1-F and DEN 1-R, the probe in step g is dengue virus type I probe DEN 1 -probe, the fluorescence detection value is 915, confirming that the sample contains Dengue virus type I;
[0148] When the first round of PCR primer F and the first round of PCR primer R in step d are deng...
example 3
[0157] It is known that the sample contains dengue virus type II (DEN-2), and it is detected according to the method of the present invention. The specific steps are the same as in Example 1, and the results of the fluorescence detection value are as follows:
[0158] When the first round of PCR primer F and the first round of PCR primer R in step d are Japanese encephalitis virus primers JEV-F and JEV-R, and the probe of step h is Japanese encephalitis virus probe JEV-probe, the fluorescence The detection value is 479, confirming that the sample does not contain Japanese encephalitis virus;
[0159] When the first round of PCR primer F and the first round of PCR primer R in step d are dengue virus type I primers DEN 1-F and DEN 1-R, the probe in step g is dengue virus type I probe DEN 1 -probe, the fluorescence detection value is 15, confirming that the sample does not contain dengue virus type I;
[0160] When the first round of PCR primer F and the first round of PCR prime...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap