Specific B cell epitope polypeptide of NS1 protein of encephalitis B virus and use thereof
A Japanese encephalitis virus and antigen epitope technology, applied in the field of molecular immunology, can solve problems such as affecting the diagnosis results, and achieve the effects of stable detection results, high antigen purity, and easy uniform quality
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 Fusion expression and purification of JEV NS1 protein
[0027] According to the JEV SA14-14-2 strain NS1 gene sequence (gene sequence number: AF315119), design a pair of primers, the upstream primer is: 5'CGC CCATGG ACACTGGATGTGCCATTGAC 3' is at the 5' end primer NcoI restriction site of the upstream primer; the downstream primer is: 5'TTA GGATCC TTAAGCAGCGACTAGCACCATACC The 5' end of the 3' downstream primer introduces a terminator and a BamH I restriction site. Total RNA was extracted from JEV-infected BHK-21 cells, and NS1 gene was amplified by RT-PCR. The NS1 protein gene was cloned into the prokaryotic expression vector pMAL-c5X through NcoI and BamH I restriction sites, and the recombinant fusion expression plasmid pc5X-NS1 was constructed. After the recombinant plasmid transformed the host strain ER2523, the soluble fusion protein MBP-NS1 ( figure 1 ). Further optimized the induction expression condition is 28 ℃, 0.3mmol / L IPTG induction 4h. The ...
Embodiment 2
[0028] Example 2 Replication and preparation of NS1 protein monoclonal antibody
[0029] The expressed and purified fusion protein MBP-NS1 was used as the immunogen to immunize 6-week-old BALB / c mice. Lymphocyte hybridoma technology was used for fusion, and a hybridoma cell that secreted specific antibodies against JEVNS1 was obtained by limiting dilution method. Named 3G11. It was determined that the subclass of 3G11 monoclonal antibody belonged to IgG2a, and the light chain was κ chain. The ELISA titer of the antibody in mouse ascites prepared by the strain hybridoma cells reached 204,800, and Western blot confirmed that the antibodies secreted by the hybridoma cells can specifically react with the JEV NS1 protein ( figure 2 ), the indirect immunofluorescence test showed that the monoclonal antibody 3G11 could recognize the natural JEV NS1 protein. At the same time, it also shows that the epitope of the monoclonal antibody is a linear epitope located on the surface of NS1 p...
Embodiment 3
[0030] Example 3 Overlapping Polypeptide Fusion Expression Series JEV NS1 Protein Antigen Polypeptide Fragments and Indirect ELISA Screening Monoclonal Antigen Epitopes
[0031] According to the amino acid sequence of JEV NS1 protein, a series of polypeptides are designed, and these polypeptides overlap with each other and cover the full length of JEV NS1 protein. According to the amino acid sequence of each polypeptide, a pair of DNA strands are designed and synthesized, and the DNA strands are inserted into the expression vector and GST for fusion expression. A series of recombinant proteins fused and expressed with JEVNS1-specific monoclonal antibodies were analyzed to identify their linear epitopes. The specific process is as follows:
[0032] Design of polypeptide sequence→synthesis of DNA chain encoding polypeptide sequence→construction of polypeptide fusion expression vector→induction expression→expression of fusion protein affinity chromatography purification→expressi...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 