Unlock instant, AI-driven research and patent intelligence for your innovation.

Specific B cell epitope polypeptide of NS1 protein of encephalitis B virus and use thereof

A Japanese encephalitis virus and antigenic epitope technology, applied in the field of molecular immunology, can solve problems such as affecting the diagnosis results, and achieve the effects of stable detection results, easy uniformity of quality, and reduction of false positive rate.

Active Publication Date: 2013-07-03
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

JEV E protein is very easy to produce serological cross-reaction with other flaviviruses such as dengue virus and West Nile virus, which will affect the diagnostic results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific B cell epitope polypeptide of NS1 protein of encephalitis B virus and use thereof
  • Specific B cell epitope polypeptide of NS1 protein of encephalitis B virus and use thereof
  • Specific B cell epitope polypeptide of NS1 protein of encephalitis B virus and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Fusion expression and purification of JEV NS1 protein

[0027] According to the JEV SA14-14-2 strain NS1 gene sequence (gene sequence number: AF315119), design a pair of primers, the upstream primer is: 5'CGC CCATGG ACACTGGATGTGCCATTGAC 3' is at the 5' end primer NcoI restriction site of the upstream primer; the downstream primer is: 5'TTA GGATCC TTAAGCAGCGACTAGCACCATACC The 5' end of the 3' downstream primer introduces a terminator and a BamH I restriction site. Total RNA was extracted from JEV-infected BHK-21 cells, and NS1 gene was amplified by RT-PCR. The NS1 protein gene was cloned into the prokaryotic expression vector pMAL-c5X through NcoI and BamH I restriction sites, and the recombinant fusion expression plasmid pc5X-NS1 was constructed. After the recombinant plasmid transformed the host strain ER2523, the soluble fusion protein MBP-NS1 ( figure 1 ). Further optimized the induction expression condition is 28 ℃, 0.3mmol / L IPTG induction 4h. The ...

Embodiment 2

[0028] Example 2 Replication and preparation of NS1 protein monoclonal antibody

[0029] The expressed and purified fusion protein MBP-NS1 was used as the immunogen to immunize 6-week-old BALB / c mice. Lymphocyte hybridoma technology was used for fusion, and a hybridoma cell that secreted specific antibodies against JEVNS1 was obtained by limiting dilution method. Named 3G11. It was determined that the subclass of 3G11 monoclonal antibody belonged to IgG2a, and the light chain was κ chain. The ELISA titer of the antibody in mouse ascites prepared by the strain hybridoma cells reached 204,800, and Western blot confirmed that the antibodies secreted by the hybridoma cells can specifically react with the JEV NS1 protein ( figure 2 ), the indirect immunofluorescence test showed that the monoclonal antibody 3G11 could recognize the natural JEV NS1 protein. At the same time, it also shows that the epitope of the monoclonal antibody is a linear epitope located on the surface of NS1 p...

Embodiment 3

[0030] Example 3 Overlapping Polypeptide Fusion Expression Series JEV NS1 Protein Antigen Polypeptide Fragments and Indirect ELISA Screening Monoclonal Antigen Epitopes

[0031] According to the amino acid sequence of JEV NS1 protein, a series of polypeptides are designed, and these polypeptides overlap with each other and cover the full length of JEV NS1 protein. According to the amino acid sequence of each polypeptide, a pair of DNA strands are designed and synthesized, and the DNA strands are inserted into the expression vector and GST for fusion expression. A series of recombinant proteins fused and expressed with JEVNS1-specific monoclonal antibodies were analyzed to identify their linear epitopes. The specific process is as follows:

[0032] Design of polypeptide sequence→synthesis of DNA chain encoding polypeptide sequence→construction of polypeptide fusion expression vector→induction expression→expression of fusion protein affinity chromatography purification→expressi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses the sequence of a specific B cell epitope polypeptide of an NS1 protein of encephalitis B virus and the use of the epitope polypeptide in the diagnosis of encephalitis B virus and a screening method of specific B cell epitope polypeptide of NS1 protein of encephalitis B virus, and belongs to the field of molecular immunology. The amino sequence of the epitope polypeptide is represented by SEQ ID No.1 or SEQ ID No.2. The specific B cell epitope synthetic polypeptide of the JEV NS1 protein, the coupling antigen of the synthetic epitope polypeptide and the epitope fusion expression protein can be used for specifically detecting a JEV NS1 protein antibody generated in body which is immunized and infected. The epitope polypeptide can be used for diagnosis of JEV infection, evaluation on immunity effect and identification and diagnosis of immunity of inactivated vaccine and natural infection.

Description

technical field [0001] The present invention relates to antigenic epitope polypeptides, in particular to Japanese encephalitis virus JEV NS1 protein-specific B cell antigenic epitope polypeptides. The present invention also relates to the application of the antigenic epitope polypeptides in the diagnosis of Japanese encephalitis virus, which belongs to molecular immunization field of study. Background technique [0002] Japanese encephalitis is an important mosquito-borne zoonotic disease caused by Japanese encephalitis virus (JEV). The virus was first isolated from the brain tissue of patients in Japan in 1953, so it is called Japanese encephalitis virus, and the disease caused by it is called Japanese encephalitis B in Japan. In my country, the virus was first isolated in 1940. In order to distinguish it from Japanese encephalitis, it was named Japanese encephalitis, or Japanese encephalitis for short. Worldwide, there are 30,000-50,000 JE cases every year, about 25%-30%...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K7/06C12N15/40G01N33/569
Inventor 华荣虹步志高
Owner HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More