Unlock instant, AI-driven research and patent intelligence for your innovation.

Promoter of gene OsRTS2 expressed specifically in rice root tip and applications thereof

A technology for expressing genes and promoters, applied in the field of plant genetic engineering, can solve problems such as abnormal species morphology and physiological function, few types of crops, and no intellectual property rights, and achieve the effect of large technology reserve value

Inactive Publication Date: 2012-11-07
ZHEJIANG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When these promoters are used to regulate the expression of target genes, because a large number of target proteins appear in unwanted cells, it is often easy to cause abnormalities in species morphology and physiological functions
Although there are also reports on the isolation and cloning of a small number of specific promoters in the world, the types of crops involved are very limited, and we do not have intellectual property rights, which will be limited to production applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Promoter of gene OsRTS2 expressed specifically in rice root tip and applications thereof
  • Promoter of gene OsRTS2 expressed specifically in rice root tip and applications thereof
  • Promoter of gene OsRTS2 expressed specifically in rice root tip and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] According to related studies, it is known that OsRTS2 may be a specific gene expressed in root tip tissue. Design specific primers according to the upstream sequence of the OsRTS2 gene coding region, and use the genomic DNA of wild-type Nipponbare as a template to amplify the full-length 1342bp OsRTS2 gene promoter, its nucleotide sequence is shown in SEQ ID NO: 1 (i.e. as shown in described in the sequence listing).

[0020] The primer sequences are as follows:

[0021] Upstream primer: CGTGGGCTCGTACAAC

[0022] Downstream primer: CCCAAAGCTCTATCATATCAA

[0023] The extraction method of the genomic DNA of wild-type Nipponbare is:

[0024] The leaves of the wild-type rice variety Nipponbare were cooled and ground with liquid nitrogen, and the genomic DNA was extracted by the CTAB method. The specific process is as follows:

[0025] 1) Add 2-ME / CTAB preheated at 65°C to the pulverized tissue, mix to make it fully wet, incubate at 65°C for 10-60min, and mix well from t...

Embodiment 2

[0053] Mature rice seeds were dehulled and sterilized, placed on mature embryo induction medium, and cultured in a light incubator at 28°C for 3 weeks. Embryogenic callus tissue (light yellow, dense and spherical) that split naturally was picked, placed in a subculture medium, and subcultured in a light incubator at 28°C to obtain rice callus. Rice calluses were infected with Agrobacterium transformed with OsRTS2P-GUSplus plasmid, co-cultured, and selected on a medium containing G418 antibiotic. The callus capable of normal growth is differentiated, rooted, seedling-trained and transplanted to obtain transgenic plants and transgenic plants. The rice genetic transformation system mediated by Agrobacterium (EHA105) was optimized based on the method reported by Hiei et al. (1994). The offspring of transgenic seedlings obtained after staining with GUS staining solution image 3 shown.

[0054] It indicated that GUS driven by the OsRTS2 gene promoter was specifically expressed i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a promoter of a gene OsRTS2 expressed specifically in a rice root tip, a nucleotide sequence of the promoter is shown in SEQ ID NO: 1. The invention also discloses applications of the promoter of a gene OsRTS2 expressed specifically by a rice root tip and the applications comprises creating transgenic rice and marking strains for establishing rice tissue specific expression. The promoter is functioning in promotions of specific expressions of downstream encoding genes in cells of rice root cap surface layers and in rice flower pesticides.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. Specifically, the present invention relates to cloning the upstream promoter nucleotide sequence of the rice OsRTS2 (rice root tip specific 2) gene coding region. And it can initiate the specific expression of downstream coding genes in rice anthers. Background technique [0002] The root system is an important organ for plants to absorb water and nutrients. The root structure can be roughly divided into four parts: root cap, meristematic zone, elongation zone and root hair zone. Cells divide and proliferate continuously in the meristematic zone, and new cells differentiate and develop to form various tissues of the root. Developing cells increase in size, forming zones of elongation. The volume of the developed cells no longer increases rapidly, and hair-like protrusions occur on the cells at the epidermis to form the root hair area. The increase in the volume of cells in the elonga...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/82A01H5/00
Inventor 莫肖蓉张麝龙吴平
Owner ZHEJIANG UNIV