Promoter of gene OsRTS2 expressed specifically in rice root tip and applications thereof
A technology for expressing genes and promoters, applied in the field of plant genetic engineering, can solve problems such as abnormal species morphology and physiological function, few types of crops, and no intellectual property rights, and achieve the effect of large technology reserve value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] According to related studies, it is known that OsRTS2 may be a specific gene expressed in root tip tissue. Design specific primers according to the upstream sequence of the OsRTS2 gene coding region, and use the genomic DNA of wild-type Nipponbare as a template to amplify the full-length 1342bp OsRTS2 gene promoter, its nucleotide sequence is shown in SEQ ID NO: 1 (i.e. as shown in described in the sequence listing).
[0020] The primer sequences are as follows:
[0021] Upstream primer: CGTGGGCTCGTACAAC
[0022] Downstream primer: CCCAAAGCTCTATCATATCAA
[0023] The extraction method of the genomic DNA of wild-type Nipponbare is:
[0024] The leaves of the wild-type rice variety Nipponbare were cooled and ground with liquid nitrogen, and the genomic DNA was extracted by the CTAB method. The specific process is as follows:
[0025] 1) Add 2-ME / CTAB preheated at 65°C to the pulverized tissue, mix to make it fully wet, incubate at 65°C for 10-60min, and mix well from t...
Embodiment 2
[0053] Mature rice seeds were dehulled and sterilized, placed on mature embryo induction medium, and cultured in a light incubator at 28°C for 3 weeks. Embryogenic callus tissue (light yellow, dense and spherical) that split naturally was picked, placed in a subculture medium, and subcultured in a light incubator at 28°C to obtain rice callus. Rice calluses were infected with Agrobacterium transformed with OsRTS2P-GUSplus plasmid, co-cultured, and selected on a medium containing G418 antibiotic. The callus capable of normal growth is differentiated, rooted, seedling-trained and transplanted to obtain transgenic plants and transgenic plants. The rice genetic transformation system mediated by Agrobacterium (EHA105) was optimized based on the method reported by Hiei et al. (1994). The offspring of transgenic seedlings obtained after staining with GUS staining solution image 3 shown.
[0054] It indicated that GUS driven by the OsRTS2 gene promoter was specifically expressed i...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap