Sequence of the glo/pi MADS-box gene and its coded amino acid sequence
An amino acid and nucleotide sequence technology, applied in genetic engineering, plant genetic improvement, DNA preparation, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Example 1 Extraction of total RNA
[0055] Take the flowers of Paphiopedilum of the same color, and use the following extraction steps:
[0056] Grind the sample into powder in liquid nitrogen, quickly add 500 μl of Solution D, 500 μl of water-saturated phenol, 200 μl of 3 M sodium acetate (pH 5.2), 50 μl of 4 M β-mercaptoethanol at the rate of 10 ml / g sample, Shake and mix thoroughly, and place at room temperature for 1 min; add 200 μl chloroform, shake vigorously for 1 min; centrifuge at 12 000 g for 10 min at 4 °C, carefully transfer the supernatant to another RNase-free centrifuge tube; add silica to suspend Solution 100 μl, absolute ethanol 200 μl, 3 M sodium acetate (pH 5.2) 200 μl, mix slowly with a micropipette, room temperature, centrifuge at 12 000 g for 1 min, discard the supernatant; add 1 ml of 70% ethanol, Mix with a pipette, centrifuge at 12 000 g for 1 min at room temperature, discard the supernatant, and repeat twice; dry at room temperature for 8-10 m...
Embodiment 2
[0057] Example 2 Synthesis of the first strand of cDNA and amplification of full-length double-stranded cDNA by LD-PCR
[0058] cDNA first-strand synthesis: follow SMART TM The operation steps of PCR cDNA Synthesis Kit (CLONTECH, U.S.A.), take 1.0 μg of total RNA of Phyllostachys chinensis, mix with 1.0 μl of reverse transcription primer 3' SMART CDS Primer ⅡA (12 μM), and put it on the PCR machine at 72°C for 3min , then 42°C, 2min, quickly take out, put at room temperature, then add 5×First Strand Buffer 2μl, DTT (100 mM) 0.25μl, dNTP Mix (10 mM of each dNTP) 1μl, SMART ⅡA Oligonucleotide (12 μM) 1μl , Rnase inhibitor 0.25μl, Power Script Reverse Transcriptase (100U) 1μl, the reaction system is 10μl. The reaction program was 60 minutes at 42°C, 7 minutes at 72°C, and finally stored at -20°C for future use.
[0059] LD-PCR method to amplify full-length double-stranded cDNA: Preheat the PCR instrument to 95°C, take 2 μl of diluted ss cDNA as the reaction template, Deionized...
Embodiment 3
[0060] Example 3 Design primers and synthetic primers
[0061] Download related species from the GenBank database (such as Paphiopedilum longifolia, Cymbidium arvensis, Claw orchid, Chunlan, Cymbidium, etc.) GLO / PI The amino acid sequence encoded by -like MADS-box gene was compared with CLUSTAL X (1.8) to determine the conserved region of the amino acid sequence, and the primers were designed according to the conserved region sequence RQVTFSK GLO / PI F1 (5'→3'): CGGCAAGTGACCTTCTCGAAG; Design degenerate primers based on the conserved region sequence MLEEENKR GLO / PI R1 (5'→3'): CTTTTATTTTCCTCTTCCAGCAT. The PCR amplified fragment size is about 430bp. The primers were designed and synthesized by Shanghai Handsome Biotechnology Company.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com