Method for detecting hepatitis C virus antibody in serum

A hepatitis C virus and serum technology, applied in the biological field, can solve the problems of low sensitivity and specificity, unable to diagnose and treat, unable to reflect the changes of hepatitis C virus antibody, etc., and achieve the effect of high sensitivity and specificity

Inactive Publication Date: 2012-01-04
方辉
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the sensitivity and specificity of such methods are not high, and they can only be applied to the qualitative detection of HCV antibod

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting hepatitis C virus antibody in serum
  • Method for detecting hepatitis C virus antibody in serum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1. Taking the detection of hepatitis C virus core antibody in serum as an example, the following technical scheme is formulated.

[0022] Step 1. Construction of recombinant plasmid: Design and synthesize a primer pair (upstream primer: 5' AGCACAAATCCTAAACCTC 3', downstream primer: 5' AGCGGAGACCGGGGTGGGG 3') based on the hepatitis C virus core antigen sequence (Genbank #AF177036.1) to obtain DNA from hepatitis C patients Viral RNA extracted from whole blood was used as a template to amplify the hepatitis C virus core antigen gene (HCV core) and cloned into T vector for sequencing verification. Use the pGluc-basic (NEB product) plasmid as a template to amplify the Gaussia luciferase (Gluc) gene fragment by PCR, and artificially add the nucleotide sequence corresponding to the FLAG protein at the 5' end of the primer, and clone the amplified FLAG-Gluc Into the pcDNA3.1 vector, and at the same time clone the hepatitis B virus core antigen gene from the T vector ...

Embodiment 2

[0026] Example 2. The dose effect between the antibody and the activation level of the reporter gene: the activation level of the reporter gene was detected by the scheme in Example 1 with serially diluted HCV antibody (Abcam product) and Flag antibody respectively, and the results were as follows figure 2 As shown, it is suggested that there is a linear dose effect between the activation level of the reporter gene and the amount of antibody, which can be used for quantitative detection of antibody.

[0027] Fang Hui

[0028] A method for detecting hepatitis C virus antibody in serum

[0029] 3

[0030] 1

[0031] 8

[0032] PRT

[0033] Artificial sequence

[0034] 1

[0035] AspTyrLysAspAspAspAspLys

[0036]

[0037] 2

[0038] 570

[0039] DNA

[0040] Artificial sequence

[0041] 2

[0042] agcacaaatcctaaacctcaaagaaaaaccaaaagaaacaccaaccgtcgcccacaagacgttaagtttccgggcggcggccagatcgttggcggagtatacttgttgccgcgcaggggccccaggttgggtgtgcgcgcgacaaggaagacttcggagcggtccc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of biotechnology and in particular relates to a method for detecting hepatitis C virus (HCV) antibody in serum, which comprises the following steps of: constructing an HCV gene and reporter gene recombinant plasmid provided with tagged protein gene, introducing the recombinant plasmid into a mammal cell line for expression, purifying fusion protein by using the tagged protein antibody, incubating the fusion protein and the serum, capturing an antigen-antibody complex by using immunomagnetic beads, and adding a reporter gene substrate to detect reporter gene activation level so as to reflect the content of the HCV antibody.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for detecting hepatitis C virus antibody in serum. Background technique [0002] Hepatitis C is caused by hepatitis C virus, which is a more serious infectious disease than hepatitis B, and can easily transform into liver cirrhosis and liver cancer. There are two main detection methods for diagnosing hepatitis C: one is to detect HCV RNA by PCR amplification method, and the other is to detect HCV antibody. [0003] At present, the enzyme-linked immunosorbent method is mostly used to detect hepatitis C virus antibody in clinical practice. First, the anti-human IgG antibody coated in the well of the detection plate is used to capture the hepatitis C virus antibody, and bacteria, yeast or insect cell lines are used to express the recombinant antigen, and the antigen is combined with HRP, etc. Enzyme cross-linking uses HRP-labeled antigen to generate specific affini...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): G01N33/68
Inventor 方辉
Owner 方辉
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap