Preparation method for recombinant human interferon alpha-2b free of methionine

A technology of recombinant human interferon and methionine, applied in the directions of interferon, botanical equipment and methods, biochemical equipment and methods, etc., can solve the problem of affecting interferon activity, low yield, increasing the incidence of adverse reactions, etc. question

Active Publication Date: 2012-03-07
ANHUI ANKE BIOTECHNOLOGY (GRP) CO LTD
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Interferon is a protein, and its translation modification process is also the same, but the N-terminal Met is not a necessary residue for its mature structure. The presence of the N-terminal Met affects the activity of interferon and increases the incidence of adverse reactions
[0004] People have tried many methods to remove the Met at the N-terminal of the protein: first, cyanogen bromide has been used to cleave Met in a strong acid environment, but the limitation of this method is that there cannot be other Met residues inside the protein; Introduce protease-specific short peptides in front of the protein, and then the short peptides will be excised by their respective proteases in vitro, such as factor Xa, enterokinase, and apolipoproteinase C; third, use aminopeptidase from Proteomonas lysolyticus to excise in vitro ; Fourth, a signal peptide is introduced before the target protein for secreted expression, but the yield of this method is very low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method for recombinant human interferon alpha-2b free of methionine
  • Preparation method for recombinant human interferon alpha-2b free of methionine
  • Preparation method for recombinant human interferon alpha-2b free of methionine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0033] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0034] The percentages in the following examples are all mass percentages unless otherwise specified.

[0035] Below in conjunction with embodiment the present invention is described in detail.

[0036] 1. Construction of recombinant human interferon-α2b expression vector

[0037] Design upstream and downstream primers P1 and P2:

[0038] P1: GG CATATG TGTGATCTGCCTCAAACCCAC

[0039] P2: GG GGATCC TTATTCCTTACTTCTTAAACTTTC

[0040] The underlined parts of P1 and P2 are Nde I and BamH I restriction sites, respectively.

[0041] Using the hIFN-α2b gene as a template, it was amplified by Polymerase Chain Reaction (PCR), and the PCR reaction program was: 94°C, 2min pre-denaturation; 94°C for 45s, 65°C for 45s, 72°C for 1min for 30 reactions Cycle; extend at 72°C for 10min; store at 4°C. The 50μl reaction system is: 10×Pfu DNA polymerase buffer (containing Mg 2+ ) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention specifically relates to a preparation method for recombinant human interferon alpha-2b free of methionine, which belongs to the field of preparation of interferon. According to the method, primers are designed to amplify gene segments of methionine aminopeptidase, the gene segments of methionine aminopeptidase are cloned into the expression plasmid of pACYCDuct-1 to obtain the recombinant expression plasmid of pACYCDuct-1-MetAP which is introduced into the recombinant expression plasmid of pJW2-rhIFN-alpha-2b containing human interferon alpha-2b genes, 0.1 mu M IPTG is utilized to induce methionine aminopeptidase to express, human interferon alpha-2b protein is induced to express at a temperature of 40 DEG C, and methionine at N terminal of the human interferon alpha-2b protein is resected in the process of expression. The preparation method provided in the invention enables unnecessary Met residue at the N terminal of human interferon alpha-2b to be removed, stability and antiviral activity of human interferon alpha-2b to be improved, immunogenicity of human interferon alpha-2b to be reduced and an incidence rate of adverse reactions during utilization of human interferon alpha-2b by patients to be reduced.

Description

technical field [0001] The invention belongs to the field of interferon preparation, and in particular relates to a preparation method of demethionine recombinant human interferon-α2b. Background technique [0002] Interferon (IFN) is a glycoprotein produced by viruses and other types of interferon inducers that stimulate the reticuloendothelial system (a type of human immune system), macrophages, lymphocytes, and somatic cells. Directly kill or inhibit the virus, mainly through the action of cell surface receptors to make cells produce antiviral proteins, thereby inhibiting the replication of hepatitis B virus; at the same time, it can also enhance the activity of natural killer cells (such as NK cells), macrophages and T lymphocytes Vitality, thereby playing an immunomodulatory role. [0003] During protein translation, the initiation codon ATG is translated into methionine (Met) and remains at the N-terminus of the translation initiator, which generally needs to be excis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/21C12N15/70C07K14/56
Inventor宋礼华邹文艺陈露露朱伍进王晨露
OwnerANHUI ANKE BIOTECHNOLOGY (GRP) CO LTD